Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y40H7A.7   

sjj_Y40H7A.7 RNAi (5)
PCR_productsjj_Y40H7A.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y40H7A.6 Source_evidenceePCR21WS150 Sequence/Annotation Release
Y40H7A.7 Source_evidenceePCR624WS150 Sequence/Annotation Release
Overlaps_Gene (8)
Overlaps_transcript Y40H7A.7 Source_evidenceePCR624WS150 Sequence/Annotation Release
Y40H7A.6 Source_evidenceePCR21WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y40H7A.72266ctcccttcaacaattttcttgtggcaagtgtgaagaaggagaaactggaaactgaaacgtatagtttcacaaaagcccagctccaacagctgctcgaaaaagcggtagttttgctaattatcgcgttttgtcactaatttactgtatttcagaacgcgaaatcggccagccaccaagaaaatctagatctagaagaagagaaagatgaagacgatgaatacgaggaagccggtgaaacaagcaacacctaccaatcgggaatttcggatgacgacgatgaagaccgggattcttcaatttcagacggtagacattaggataaaaacattaattaaaaccatattttcagatgagctgttccagatttttgaaatctgaatctcgcagaactcggatcgatatggtaaggcccgaagaacaacatatctctgttaaatcgataattttagagcaatatcaccgcggaattcgtcatcaacaatttgatcggggaacctgccctgagtattcttggattaagtggaggtttaaattcagaaaagcaagcaattcgctaaaaaaaattttcagaacaacataatgtgcaggagatcttcatagctggactaaaaccaatgtgatgtcaacgtgcaagattgatccagaacgcggcaaacatttgggtggccgctgtaagttgtgaaatctccagatgtagttaaaatagttcacttttcagacaattcctccagagctcctccacaccttcagtatctaccccaattcggtgaatcatcagattcttccaggaagacttctcaattggcctatcagtaagctattcttgtccaatttgtttcaaaacaaaaattttcaggcgttcattctacatattgtatccggattcgaaggacagttcccgagtgcggattttggagatattttctcccgacaggtggatcaaaaattgtaaacactgttttctatttgcgttattacgggaccatgagatcatgagaatgcctatttactggcgcgaaaatattggcaggccgcggcagctagagagcgtgtggcgaagagagacgcaggtctcttcgctacgagatatttgccgccagaaaagtaggcattctcatgatctcatggtcccgtaataccaaaactcaaaaatattccagcttgaacgcacgaagaaagatgagccaaaaaaagaaacaccatcacactgatcgctcgaagggaaacaactgtcttattcggcttaattctgctattaattttttgttgttgtgttttttgagatttttttgttagaatttcgttttcctttatcgatttgttttaggtttcatttgttatttacttatttgttggattttaatttattgcttctcctttctattttgtatattaacgagtccccacgaaaaggggagcagaacgaaaaggggatctgcaaaaaggggatctgcgaaaaggggagatacgaaaaggggagatacgaaaaggggagcaacgaaaaggggagctggcactgtgccaaacgcacaaaacgcattttttcttacgcaacgcacgttgatttttaaaattttcttctagaagatacgcttaacaacacgcgacgcgtaacatcggagcatcgttgtatcgttttcttcgagaaaaatagcgattggcacagcgccagatccccttttcgttgctccccttttcgtatctccccttttcgcagatcccctttttgcagatccccttttcgttctgctccccttttcgtggggcctcatattaacgcccatccttccccaacattcttaaattttttctaatcccgttaatttccaaaatattcgactgtaacttttttaaagttttttttttgttttcttagtttataaataaatattatttttgaaaaacaatcgtaatttgcgttttagatggttaaacgataggaaggggaaggagcgggctgcgaactgccattgctgcaagaccacgcaggcaacgcgttgaaaccacgcagggactggcattcatgagcgtggtttgtacgcgttgcctgcgtggtttggaggcgacgcctgtgtggtttgatttatctgagatgttagctttcaacaaaaaaacactcacagacattccaaccaacactttcgagacattccttgaaatttgcggcttgctatataattttagcagacaaaacgccaagaatctattaaaaacttataattttttgatttataacaatatttaccgatcaaaagtcagtgaaaaa