Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y41C4A.11   

sjj_Y41C4A.11RNAiJA:Y41C4A.11
PCR_productsjj_Y41C4A.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY41C4A.11 Source_evidenceePCR743WS150 Sequence/Annotation Release
Overlaps_Gene Y41C4A.11 Source_evidenceePCR743WS150 Sequence/Annotation Release
Chunk_score Abs_score680
Max_abs_score680Y41C4A.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1172156811723215
Overlaps_transcriptY41C4A.11 Source_evidenceePCR743WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y41C4A.111648atgggaaaaatggtaaagcagattagatttatctgaaaaatgtcctctccagctccaaacttcgtttcccactcggatcgcgtcaagtcggtggactttcattctgagaagccatggattttgactgctttgcacactggaaatgttcaaatctggaattatgacactaaaacgttggtcaaggctatggaggtgagttaaaacgattctgatttttcagtaaaggagggggtgtactctagctctacttacataggggtgcttatctcagcggagagaaaatttttcagaaaaatatctactagcaagttatagaaaattttaatttcccacattttccaaattgatcacttttctatttcaactctccagccccgataaactggtttttactaattttttgaaacttttgtattttttggttcttttttttcggtcgttttttatggaatttatgatcgacttcggaatgcccaatttttcctgacttttgacttttttgacttttttttggatttttcggaatatctgggtatttctcttttccctcccccagccccgcctaagcctaagactaagcctatacgtaagcctaaacctaagcctaagcctaagcctgagcctaagcctaagcataaccataacccgaagcataagcctaagcctaagcctaggcataagcctaatcctacccgaagcgtaagcctaagtctaagcctacgcctcagcctaagcctaaactagaacattcacattacatttgccaagtttttcaccgtttcaaaattcataaattatatttccaggtctccgaaaaatccacgcgtgccgccaaattcatccatcgtaaaaactggatcgccaccgcttccgatgatcagcaaatccggatcttcgacgctgaaacgttcagcctaatcaacgagttcacagctcactctgactttattcgctccctaaccgtgcacccgacacttccctacctcatatcggcttccgacgatcgtaagatccgagtttgggattgggaaaacgagtggagaatggagcaggaattccaggagcatgctcattatatcatgcaaattgccgtgaaccctgaagacccggagatgtttgtcagtggatcgttggataaaactttgaaagtctggaagctcggtgagcaagagtcgatttgcactctggagggtcatgagaagggggtgaattgtgtggagtttctgaccggtgggagaattgtttcgggctccgatgattgctcaatttgtgtttgggatattcaggtgagcgggaatttgaagttttataaacatggtgcatcgagcggaaacaccacgcttaactttaggagctcgtatatcgctggtattttattctatcaaaatgttgctaattgacaaaatattctttgtttgtttctctataattttgtaattgacaactatttgataaagtccaaaccaaccaagataaaagtggtcaaagtttaaaaaaagacatggtgcatcggaacatttttcagacccaaaaatgcattgaaactctaaaaaatgctcacaaaaacaacgttacctttgtcaccccattcaagacatggattatctccggagccgaggattctactgtaaaaatttggaattcgcag