Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y41E3.10   

sjj_Y41E3.10 RNAi (5)
PCR_productsjj_Y41E3.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY41E3.10 Source_evidenceePCR792WS150 Sequence/Annotation Release
Overlaps_Gene Y41E3.10 Source_evidenceePCR816WS150 Sequence/Annotation Release
Chunk_score Abs_score732
Max_abs_score732Y41E3.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1503719815039336
Overlaps_transcriptY41E3.10 Source_evidenceePCR816WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y41E3.102139agtatttctagcgctgttgttcggttttttatttgttttgacgctcggaaaatttatttataactttatttaatgtgccagcatagtttattattcaattttcaggtaaaacaatgtctgtcgagggtcttctctctgaggtcaagcacttcaacgctcatcatttggatgctgctcttggagaacaattgttctatggagggaagcgtgtcttctccgacgttaagccaggaacttcttctggtggtgaccacggtatttattattattttttatataaaatgtttaatattcaagtcttttaggatgcaagggaggaaagagcgagctcaagggagctatccacaatgccaagcatgccgctgataaggctttgaacaaagaaggtaaatttggcattttctgaaagctaatttaacgcatttctgtttcaggaggagaggacgtctccaagcttcgcgaagagcactctgctcttgccaagaaggtcgacgacttggccagtcttgtcgctgagcttcaacttcaactctcgactcttcgccaaggacaggtaaatcatcgtcgtcacgttttgattcttggcgacggaaatctctcgttttcccttgccattgcgtcgtcagatccggaaactgtatactttgcaactgtttttgattcgaaagaacagtttttgaaaaaatacaacgctcatgacacgttaaacgctctagacgctttgagcaatgtgatcctatgttttggagttgacgcgacagatctgccggttcgctggagcaacatctttaacacggttatcatgaattttccacaccctggcggtaaaaccaatctgagaaagagtaaaattttgctctccggaatttttgcttccctcagaagtattatggatagccaagcagtatttcttctcagtcttgccattggacagtctgggctcgagaaggtctctgatccgtggatgaacgagctcccaagtcacaaaaaagattcctggcaggcaatctatctgggcgccgagaatggcttcattctcgacagtctggagaggttcgatactgatagattcgcatcttatagatcttccggttataaagagactaaaaaagggttcaataatcgtgaaggattgacattttccttcaaaaagtgtgataatcagcagaagtctctgcgcgattttcaattggctgagcctccgaggagtggaaagttcaagttcaactactataggcccttctacgcccaggatctgtcgattttgttcaaaatcggtgagagcgaaggagagaagctcgccgtggagctcgtaaaatcgatcgctggaaattgtttagctgcgatttctgagattgaatatcttcgatccatctgcccagatccgccactcccaaataggatctacagaattatatggcacggcctcgagcttccgatgggacgtgaaatgtgctccagaatccatgaagagctaagaaatcggattgctgaggagattgtcgccaataatcttccactggtgctcacctgaaagatctgctcgtcttctgttaatttatttgttgtatgttattgttatgaaaaaataatcgttgaaaaagttgcgaagttatagtttccgaggtccaaaagccttaattttatattttccattttctaatactaattttttgttttcagaccagctccgtcgctgctccagctgccgcaccagccgctgctaaagaggaagctgccggagacgacgacttcgatcttttcggatccgaagacgaggaagaggacgaggagaagaagaaggtcgttgaagagcgccttgctgcctacgccgcaaagaaggccacaaaggccggcccaatcgccaagtcctcggtcatccttgacgtaaagccatgggatgacgagactgatctcggagagatggagaagctcgtcagatccatcgagatggacggacttgtctggggaggtgccaagctgatcccaatcggatacggaatcaagaaactccagatcatcaccgtcatcgaggatctcaaggtttcggtcgatgatctcatcgagaagatcaccggagacttcgaggatcacgtccaatccgtcgatattgttgccttcaacaagatctaaaggcct