Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y41E3.2   

sjj_Y41E3.2 RNAi JA:Y41E3.2
Simmer:Y41E3.2
PCR_productsjj_Y41E3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY41E3.2 Source_evidenceePCR870WS150 Sequence/Annotation Release
Overlaps_Gene (11)
Overlaps_transcriptY41E3.2 Source_evidenceePCR892WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y41E3.21131agttggtagagggcttgaagacttaacggcgggttccgtcctcgaagaagattcctccgtccaaagcgcagtacctgaaaaagtaaaaaagttaggcgactattcaaatacttgaattcagtttcaacatactttggacagattcccttctctcctggagttccgtcttgtcctggagttcctggctttcctggctctccatcctttcctggctctcctggagttcctggttctcccttggctcctggtgctcctggagctccatcgattccgttggatcctggtggtcctggtggtccttgttgtccggcctgtcctggtggtcctggtggtcctggaacggctggctcagacttggctggtgatcctggctctcctggggctccggcttgtcctggtggtcctggtggtccaatcggtccctttggtcctggctctcctggtgcggcgtctggtccctttggtccttgctctcctggtggtccgttgtctcctggaattcctggctgtcctggtggtccgggtggtccttgtgggcatggctggcatggtggtggggtggttggctcacatggttgctgtggtggacgtcctggagttcctggttgtcctggagctcctggctttcctggctttccaggctttcctggggttccctgtggtccttgtggtcctggcaagcagcagccggcgcattgctcgttgtaggtagaacgggcggtacggttggcgctcaatgggagctcgcggatggagtagacagagttccacacgtccttggcggatcccttgcaggcgtagagctcctggtgcatctgggtgcgcacgtgttgcacatagttgtacaccattgggagggtgatgcagacctgaaatagtaaaatttcaacaaaaaaaattgaaaaactagcagccggcactatattggtattcttttttgcaaaactaacaatcgcagaatatcaaaaataatcaactaggaatttaggtttattttgaaacagtaatttttttagaaaaaaaaattaaaaaataaaaacttttcttaccgaaagaacagccattgctgagaagcagacggcggcatatccgacgaagcggtaagccttaatcttcgaatcgatgtccatt