Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y43D4A.d   

sjj_Y43D4A.dRNAiJA:Y43D4A.d
PCR_productsjj_Y43D4A.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y43D4A.3 Source_evidence ePCR 984WS150 Sequence/Annotation Release
153WS150 Sequence/Annotation Release
Y43D4A.4 Source_evidenceePCR713WS150 Sequence/Annotation Release
Overlaps_Gene Y43D4A.3 Source_evidence ePCR 984WS150 Sequence/Annotation Release
153WS150 Sequence/Annotation Release
Chunk_score Abs_score756
Max_abs_score756Y43D4A.3
Specificity_index0.384
Rel_score1
Map_statusBottom50_percentile_ePCRIV1676794016769633
Y43D4A.4 Source_evidenceePCR713WS150 Sequence/Annotation Release
Chunk_score Abs_score573
Specificity_index0.291
Rel_score0.758
Map_statusBest_ePCRIV1676794016769633
C27A7.6 Chunk_score Abs_score642
Specificity_index0.326
Rel_score0.849
Overlaps_transcript (2)
WB_DNA_text sjj_Y43D4A.d_11693ggttgatttaggaactgcaagtgtagcctttttagatttaaaaaaatccatagaggaaatttagacatatagacacaatttttttcgaagaccctggtagaagaattttaactcaccattctcaatgtaatgactgaacatgaaaatccaacagtgcaaactctgattatttcctaaattttagaatgatattttctttttctgattcactcaccttgaacttgcgtgttttgtcggcaatatgaccagcgagcagtgatgttaacgtgccaacgattgcacacacggcagttggatatctgaaaaataaatgaattactcatatgcttctagaactctgcaaagttgttacccagccatctcataaccttgatctttgagtggaccatcgagaaaaatcattagactccacagaagcgaaaacgcaaatgcaaagagagtcatttggatgaaaaattgagcattactgaaattaaagtatttaaagtttttggcgtgatactaaaaacctacaaaatacattgaaggatagatttaaagaaaccaatgttgttctgatgagcagcagaagaagctgatggtggagtgggtggcagtttagttcgaacgaatagtgctagaacaaatggaaacaaggctagacattccattccaagagtctgaaaatatgaattgtcaatgataattaaattgagtactaacaaatgtgaagaacatccaactattcgaatcaatagtcttattgtgaccaaaaagaatggatggcacaattgttcccagggcaacaccggcaggatttgctgaaattgattttcttaatgaattactgacaatcattaaaatttcactaaccaacaaaagaaagtacatttgcaattgctctctgatcaccagggaaccagcattcagcaatttttgatggaagaactaaaaagaatgcttgtgctgaagcagcgataaacgatcctgcatgaagaagacattcacgaacaaaatgtgattttatgaaaggaatcgaggcaatcatccgaatcgatgctccaattacatttaaagttgtaccaagaagaccctgaataaatatttcatttggaggttaaatatttgcaattcccacagccgtttttattcctttgttatcagttatgtacattccaccaaatccagtgaacacggcgacaaactgaaaatttgatttttttttcttctcctttttttcctattttatatatattgcataacccaacaaaacctggaaaatttgatttgtgacaagtgatacatcaatgctcccgttggctggacgtcctctataatatatctaaacttcgtcggatagagagctgaagcttatccattgctgaaattacgaataatttcaaaaatttctttttcgagtttaccattgcgtttgaaagagcaagaaagcaacaaacagctagaacgagccatcgagctgggtagacctgaacattaatgaattaattaaaaattaattcactgaatatcatcagtatttaccttgtatataacactattttcgctgattcctccatttgccgaagtatccttatctgcggcgacggcttctttgttgatcgccgatcccatcaacagctgaaaaatttaattaggttcaaaagtgaagcgatgcgaacggtttagccaacgggagcattgatgtatcacttgt
sjj_Y43D4A.d_21694acaagtgatacatcaatgctcccgttggctggacgtcctctataatatatctaaacttcgtcggatagagagctgaagcttatccattgctgaaattacgaataatttcaaaaatttctttttcgagtttaccattgcgtttgaaagagcaagaaagcaacaaacagctagaacgagccatcgagctgggtagacctgaacattaatgaattaattaaaaattaattcactgaatatcatcagtatttaccttgtatataacactattttcgctgattcctccatttgccgaagtatccttatctgcggcgacggcttctttgttgatcgccgatcccatcaacagctgaaaaatttaattaggttcaaaagtgaagcgatgcgaacggtttagccaacgggagcattgatgtatcacttgtcacaaatcaaattttccaggttttgttgggttatgcaatatatataaaataggaaaaaaaggagaagaaaaaaaaaataaaattttcagtttgtcgccgtgttcactggatttggtggaatgtacataactgataacaaaggaataaaaacggctgtgggaattgcaaatatttaacctccaaatgaaatatttattcagggtcttcttggtacaactttaaatgtaattggagcatcgattcggatgattgcctcgattcctttcataaaatcacattttgttcgtgaatgtcttcttcatgcaggatcgtttatcgctgcttcagcacaagcattctttttagttcttccatcaaaaattgctgaatgctggttccctggtgatcagagagcaattgcaaatgtactttcttttgttggttagtgaaattttaatgattgtcagtaattcattaagaaaatcaatttcagcaaatcctgccggtgttgccctgggaacaattgtgccatccattctttttggtcacaataagactattgattcgaatagttggatgttcttcacatttgttagtactcaatttaattatcattgacaattcatattttcagactcttggaatggaatgtctagccttgtttccatttgttctagcactattcgttcgaactaaactgccacccactccaccatcagcttcttctgctgctcatcagaacaacattggtttctttaaatctatccttcaatgtattttgtaggtttttagtatcacgccaaaaactttaaatactttaatttcagtaatgctcaatttttcatccaaatgactctctttgcatttgcgttttcgcttctgtggagtctaatgatttttctcgatggtccactcaaagatcaaggttatgagatggctgggtaacaactttgcagagttctagaagcatatgagtaattcatttatttttcagatatccaactgccgtgtgtgcaatcgttggcacgttaacatcactgctcgctggtcatattgccgacaaaacacgcaagttcaaggtgagtgaatcagaaaaagaaaatatcattctaaaatttaggaaataatcagagtttgcactgttggattttcatgttcagtcattacattgagaatggtgagttaaaattcttctaccagggtcttcgaaaaaaattgtgtctatatgtctaaatttcctctatggatttttttaaatctaaaaaggctacacttgcagttcctaaatcaacc