Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y43D4A.d_f   

sjj_Y43D4A.d_fSequenceGGTTGATTTAGGAACTGCAAGTG
PCR_product sjj_Y43D4A.d
sjj_Y43D4A.d_1
sjj_Y43D4A.d_2