Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y43E12A.1   

sjj_Y43E12A.1 RNAi JA:Y43E12A.1
Simmer:Y43E12A.1:Repeat_a
Simmer:Y43E12A.1:Screen
PF:GL1_4D5
PCR_productsjj_Y43E12A.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS H31G24.4 Source_evidenceePCR710WS150 Sequence/Annotation Release
Y43E12A.1 Source_evidenceePCR710WS150 Sequence/Annotation Release
Overlaps_Gene H31G24.4 Source_evidenceePCR768WS150 Sequence/Annotation Release
Chunk_score Abs_score459
Specificity_index0.402
Rel_score0.671
Map_statusBest_ePCRI41151894116132
Y43E12A.1 Source_evidenceePCR768WS150 Sequence/Annotation Release
Chunk_score Abs_score684
Max_abs_score684Y43E12A.1
Specificity_index0.598
Rel_score1
Map_statusBest_ePCRIV1098621610987157
Overlaps_transcript H31G24.4 Source_evidenceePCR768WS150 Sequence/Annotation Release
Y43E12A.1 Source_evidenceePCR768WS150 Sequence/Annotation Release
WB_DNA_text sjj_Y43E12A.1_1944agacgcttcacctgacgattttcgttctggatcgaattatcgtgaagaacattgtctccaaggcggaattccagcttctcggtgttgcagctttgtaagatcgttttttttttgtaaaattatagataatcttttgtagatcagaaaattaacaatagtttttatgcaatattaatgatttcaggttcgttgcctccaaattcgaagatatttacttgccagacatcctcgaatacgagttgatcactgagaacacattcagcaagaagcagatattggctatggaacagaccatcctcaacgccttgaactttgacttgtcctgcccatcttcgcttgtcttcctccgttatatctcaaaaactctcacagagaatgacgtcaatccaatcgataaggaaacgttctattatgtgcacaatatctccaagtgtctcggagaactcgcattgctcgattcggtcatgtctacggttccaaggtcgcacgttgctagtgcttcgatgatcatcactctcaatattatctccgttgatggaattaatccgaagactgctgcatcgatgattcggtagattcaatttttttcgaaaattttacaagaatttgtttcagcaaacaattcggagcctccaagcaagatatttatgatgctatctctctgctcgctcaagtcgcatataaaaacttcagacatcagaagctttgcgccattagggtaatatatttttacaaaatgtttactcagttttgttttcaggaaaagtaccagtccagcaagtttggacgagtatcctacttgatgaccgacgaaatcttggagaaaattcaccggatggggcgcaaccttgaggcttcagaagctgaaacatcagaaatggaatgagaactatacttcatcacccaatacgttcctgtgttctgcttgtttccccattgcactt
sjj_Y43E12A.1_2942agacgcttcacctgacgattttcgttctggatcgaattatcgtgaagaacattgtctccaaggcggaattccagcttctcggtgttgcagctttgtaagatcgttttttttgtaaaattatagataatcttttgtagatcagaaaattaacaatagtttttatgcaatattaatgatttcaggttcgttgcctccaaattcgaagatatttacttgccagacatcctcgaatacgagatgatcactgataacacattcagcaagaagcagataatggctatggaacagaccatcctcaacgccttgaactttgacttgtcctgcccatcttcgcttgtcttcctccgctgtatttcaaaaactctcacagagaatgacgtcaatccaatcgataaggaagcgttctattatgtgcacaatatctccaagtgtctcggagaactcgcattgctcgattcggtcatgtctacggttccaaggtcgcacgttgccagtgcttcgatgatcatcactctcaatgttatcaccgttgatggaattaatccgaagactgctgcatcgatgattcggtagattcaatttttttcgaaaattttacaagaatttgtttcagcaaacaattaggagcctccaagcaagatatttatgatgctatcgctctgctcgctcaagtcgcatataaaaacttcagacatcagaagctttgcgccattagagtaatatatttttacaaaatgtttactcagttttgttttcaggaaaagtaccagtcgagcaagtttggacgagtatcctacttgatgaccgacgaaatcttggagaaaattcaccggatggggcgcaacgttgaggcttcagaagctgaaacatcagaaatggaatgagaactatacttcatcacccaatacgttcctgtgttctgcttgtttccccattgcactt