Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y43F4A.1   

sjj_Y43F4A.1RNAiJA:Y43F4A.1
PCR_productsjj_Y43F4A.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y43F4A.1a Source_evidenceePCR1037WS150 Sequence/Annotation Release
Y43F4A.1b Source_evidenceePCR78WS150 Sequence/Annotation Release
Overlaps_Gene Y43F4A.1 Source_evidenceePCR1037WS150 Sequence/Annotation Release
Chunk_score Abs_score890
Max_abs_score890Y43F4A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1322364913225234
Overlaps_transcript Y43F4A.1b Source_evidenceePCR249WS150 Sequence/Annotation Release
Y43F4A.1a Source_evidenceePCR1037WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y43F4A.11586gaacacgaacatccacatcgtcatcgtagaggtctaccaagttcagatccaacctcccctccagttgaaaagttcgctccattgagaatccaattacactatgacaaaagtatacagaatctgacagctgaagtacaaaattttgtgaataccacattattgcctgaagctgttggatattgggaaaatgcactaagagttcgacctatgacgacacctattcggttgagaaggtaggttgcaagaaaaaaataaatcaaaaatttgaaggcacttttaaactttttaagaaagtgtatctcctcattctactactacaagcaaggaatgcgaaatgttgcatgtgacaaaggttgccgagagagaacaacgtgtggagaggcagacattccccgtgatcatttgttggtaagttgagacacgcagcgccgtgccgtcgatagctcagttggtagagcggaggactgtagagttagcaggtatccttaggtcactggttcgaatccggttcgacggaatgcttttttaaattttattaaaataagctcgttttaagctcgtttttgaaaacttaaaacttaaaatagcaatattttaggactgtttggcatgtaataatactgatgattgtaaaaccactggagaactgggcgaaggagttaaggacacagattttatattgtaagtttagttttataagttcaaatttcaaaaattactatattaatatcactgcagatacgtcactgcgcatgactccaaaagatgcgaaggccctgaaactctgtcatatgctgctcactgccaacaagaagctgactttgatcgccctatagctggaaatgtgaatctttgcccgagcgccttgtctgttcacaatcatgattacgaaatacttacgagcactgtaaaacatgaaatacttcatgccctaggattctctgttggattatacgctttctttcgtgattcggaaggtaaacctaggacaaaaaggtaagtggacgaaaaaatttttaaaaaaagtttcgctcccgggtgggctcgaaccaccaacctttcggttaacagccgaacgcgctgcctattgcgccacggaagcacgtcgacagcgggcagggcgggcgtataagagtcctatcattgcaggaatcgctacggacgacctacctcactgaacaaacagaaagggtattatgattgggatagcaacacaataaccacggttttgagagagaattggtggactggagaaggaaaagtcagttaaaaaaaattttgtttcaaataaacttaaaatctctaggttatccacccgattcacatgatggttacgccaaaagttcgagaagaagcgcgaagacatttcggatgtgataagcttgaaggggcggagcttgagaatcaaggaggcgagggaacctatttaacacactgggaaaaacgggcatatgaggttttgaattctttgaaaataaacaaatagtttttttttaaattcagaacgaagcaatgactggcacgcacactcagaatccagtatattctcgattaacgttggcatttttggaggatacgggatggta