Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y43F8C.4   

sjj_Y43F8C.4RNAiJA:Y43F8C.4
PCR_productsjj_Y43F8C.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY43F8C.4 Source_evidenceePCR738WS150 Sequence/Annotation Release
Overlaps_Gene Y43F8C.4 Source_evidenceePCR738WS150 Sequence/Annotation Release
Chunk_score Abs_score633
Max_abs_score633Y43F8C.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1962991519632106
Overlaps_transcriptY43F8C.4 Source_evidenceePCR738WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y43F8C.42192tcagactagaagccgagctagaacgtgtaaaccgtgagcttgaagacacaaaacgcaagaaacgagaagacgaggaagatttggagaatttctggaaaaccaagctggaaatccagtcaaaagactcggaaaaggcactggaagactcaaaaactgcacaaagagcacaaatttcaaagcttcaagatgagcatcacgtggagctcgaaaggcttaaagccaattacgataggcagctagagaatgtgacgtcatcgacgagtcaggttggggatctagtggcagtggtggggaaagtggatacaatttctacgaatattgataaaattgcggcggatgtggtgtaagttgactatgtgcctttaaaattgaaaaatattaaaaaatcggtttaaaaaattttaaaaatcgaaaaattcgccccaaaacttcaaaattttaaaattttgagcagattttctgattctccgtgcaaaattacccctaaccctcaattttcagattcagattttttgtgcaactttgcgtcaaatccggtgtcttgagttactgtacctcggtgtttgcgtacctgacacctgattttacggaattttgagttagagctctgaaaaattagggaaagaggtagtttggcatgggtaatctggaaaattatataaaaatttcaggaagtttttggaaaacgctgaaattttagtaaaatccaaaaaaggtcaaaaattcacaaaccaagtgcgcaaacttggcccaaaattcaaaatgtttgaattttgagctcattttctgattctccgtgcaaaaccactcctaggcctcaattttcagatttttagtgcaactttgcgtcaaatttggtgtgttggtaccttcagtagtaccttggtgtttgcggactggacacctgattttacggaatttttgaaattttcgggataggggtaacttggcatggggaatctgaaaattcacacaaaaatttatgaaacttgaaaaaaaatcttgaaattttagaaaaaacaattcaaaaattaaaaaattcgggccaaatcttggcccaaactttgaaattttgagcagattttctgattatccgtgcgaagttacccctaatcctccattttcagatttttagtgcaactttgcgtgaaattcggtgtcttgggttactgtaccttggtgtttgcggacctgacacctgattttacggaatttggagctagagctctgaaaaactaggtctagggtagttttggatggggaatctgaaaatagacatgaaaatttctgaaaatttacagaatcctctaaaaatcctgaaaaagttgaaaaatcatgatttacgcaaaacagtccttaaaaatttgttttttttcaaatttttccttcagagctattgattctggtgctaaaaacaaattacaagtattgattttccagagcaagcaccaataaagtgagctcggagcaaagcgctcttttccacttgcaagaggaactgctgaaaattcgagagacaaagtgagtcatatctcagtagccaagcttgctatcaaaaaattgtcaactaacaacttgtagctcttgttacggagcacattttgtcagttgaaaatttttcgatagctctgcgggttctcaagttatgaagcttcaggctctccgaggatgtggcggctctgaagcttgagcaactgaaagttcatgagcttaacctaagcttgaaggatttggtcaaaaatcaacaggatgaaaatgaacaagtatgtaattagagtacaatgtttaaaatgtattggaaagttttgaaatttttgaaattttttttttaattttcaaaaaaaattttgaaaaatttttttaaaaattttttctgaaaatttccaaaaattcaaggaaaaatggaggacaaaagaggagtggaaccgtctgaaaattgaacgtcaaattttcaaggaaaatcaagaccgagtcattgaaaatgtgcagagagagaagctggacctggctaataaattggtatgctcccccctcaaaatttttggaatttttataaaatacgctcaaacatttcagaaattctaccacaaagatcaaaccgagctgcttttccggctgagcagtgaacgggagcttttggagcaggagaagagcgaattctttgcgtaagttgggttatcaacagagctacg