Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y46G5.d   

sjj_Y46G5.dRNAiSimmer:Y46G5.d
PCR_productsjj_Y46G5.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY46G5A.4 Source_evidenceePCR2122WS150 Sequence/Annotation Release
Overlaps_Gene Y46G5A.4 (3)
Y46G5A.6 Chunk_score Abs_score272
Specificity_index0.118
Rel_score0.133
Overlaps_transcriptY46G5A.4 Source_evidenceePCR2122WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y46G5.d2303gctccataatcttgtcgtacaccacttcgttcatcgcctggaacctcttcaaagccttcttctcagtaactccaatatattgttgctcgaggggaactggacgatagctgttatcaaagaagtgcaaatgctcaggcttcactcgcaagaacgtcgccacatcttgataattcggaagagttgctgaaagtccgaccagtcggcactcatcgtgattctgctccatttgacgaatcgttctgacgacgatcgactccaacaccggtccacgatcatcgtgaagcagatggatctcatcaatgatcaacagccgaaccatctggttataggctctctctccgccttttcgcgtcaccacatcatacttttccggcgtacaaacgatcacttgtgtcgccatgaactgctctttgctcatttgagcatctccggtcatttcgccgacagtgattccgaatggagcaagacgttttgagaagcttccaaccatctcttgaaccagtgacttcatcggagcaatgtagacaatcttgaactcatcgagcttcacacttccatcctctgccaagtggtttccgatttcttggagcatcgtgagcagcgccacgttcgtctttccagctccagttggagcacagagcaagagatgctctttggatcgaagagctgaatcacagagtcgggattggatcctgttcagcgacttgtagccgtcgaaagccggttgggcccatttcgggagctctgagacactgacgagcttctctccttcagcaaatggtcgtggtttgagggctggtacgtggatttcttcgtaggactttttctggcggcggtaggatccgtcggggagctcgcatctgcaaaattgagaattttagggttttttgggaatgtggacttttaaagtgcataatgaatcaaatttccttaattttctaatggaaaatcgtacttttaaaataaaattgtatttaccttttattgctcatcaaatgagatccttgactgaacgtgagatcgtttagatccaacatcttgcggcccgcctgccactgtcccgcactgatggcttcatttgctgctgtggcggccttcttcgacttctccgcgtctcgtttcgacttttccacctgcacaacagatccctcatcagtctcctgaagaagtgcaagaatcggatgaagctctggacgagatcgcatatcatcttcgatttggagacgctccttctcgttcgcctgacgcaaaagtgtacagtagaggatcataagacgattctggcgaaggcacttgatgaactcgaactgatcgaagcctaacagcaggacaagctgattctcggcgtcacgatcgtcggcggcgttcttgagaattccgatgacttccgtttgcttctgttgggcgatcagaggatctttgaagtacttggcgagcgatctttggatccaatgagcgtcgatgtcacgtggatgaagaattcctcgtgctttttgctcatcttccgtcaaatgaccatctcctttgagtgttgccgtgtaatctgtatccacaccttcttcctcttcactctcctcctcactatcacctttgatctcattaaccatcccaccgtcatcttcttcctcatccgagtcgaactgcacatttacaccctcattctcgtagatgtctccatcgccttcaggcttattctcctcttcgatcgaaaaatcgctgatcttcttcgataagttgatgagaactgcgatacgatcgtcggtgagcggtcccagaagagcttccacttctttcttcttctctgaaaaaaaaatataaattttattgaaaatcttcgattttcacctcacctttatctcggaatttgtcgtttttcagcgtgagaagcacctcgtcagcggctccgcacagaacctcgcgtggaacatcgccaagtgcgtccaaaatgaaagacaaaatcacttcataagtctgcttcgtctcctgggttctgggcttgtaggctcccatgagctcattattgtcgacaaggacattccggccgaactgttgtgctttctcgtcgtccttcttctttctcttcttcttctgatcctgcaccggcgcttttcccttgatcgcccggtcacccatcttcattttgcgcatctccttatccgtgatcggcagcacctcgccagtcggctcctctctgccacgccgatccgtcagattgtagtcgaccgacagaaccaagttggagttctgccggtactcatactgctggattcgggctagctcgtcggccattgtagtttgtagtc