Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47D3B.5   

sjj_Y47D3B.5 RNAi JA:Y47D3B.5
Simmer:Y47D3B.5:Repeat_a
Simmer:Y47D3B.5:Screen
PCR_productsjj_Y47D3B.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y47D3B.5a Source_evidenceePCR870WS150 Sequence/Annotation Release
Y47D3B.5b Source_evidenceePCR870WS150 Sequence/Annotation Release
Overlaps_Gene Y47D3B.5 Source_evidenceePCR870WS150 Sequence/Annotation Release
Chunk_score Abs_score744
Max_abs_score744Y47D3B.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1141786811419422
Overlaps_transcript Y47D3B.5a Source_evidenceePCR870WS150 Sequence/Annotation Release
Y47D3B.5b Source_evidenceePCR870WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47D3B.51555ctggctcttctaatctgtgtcgtttatgttgctggatgttcctcattgttcttgttatgggaaactcgatggacatttttcacaagtctctacttcttctgtatttcactgctgactattggattaggtaagccattttgaagaagaagaagccactttttggctctttttctgacctttttaaaatcaatgtttccaggagacattgtacctgacaaaccccatatgttcattgtaatgtttgttctagtgattgttggattaagtattgtatccatgttcatctcggtcgttcaaatcaaaattgaagaatggttgtgtcgaatgattgaacagatcaaagtgagcttatcaaaaattaccctaccgccatattatttcaaacaatttcaggaagagtatatgaaaaaggatggccttgttgatccggaagaaattaagcgaatttttgcaaatgatccggtgttaagctttgttgcaccgaagattatgtcgggcgagcagaatcatatgcttaaggacactatcaagaaatttgatcgattgttggagagtaaggagattcaaacggattttccggttaagggaatggcgactcaggtggaaaaatatgaacaggtgagttagcctgcctacctcatgcctatacctgaatttttgcggaatttttttcgatggcaagatgaacgtgcctgcctaggtacactgcctaggtacatgtggatgtacctggcaaggtgcgtgcctaggcgcctgtgcatgcctaggtgtgcatgcctgcctagatacctgtgcatgcctaggtgtctgtgcctacctaggtgtttatgccttcgtaactgttttagaggcgcgtcagcttaaaagcgaccgacatctcatgggtcttaccacccaaattgaacaattgtttctttttcaatttttgaacattgggaagtacgttactacgggtcatttttacaaaaaattgaaaagttcaaaattcatgattccaagctttttctcctgattcttgactttcgatttttacagagcatggcctgtgatccgatgagcaatcacctgaaacccgcagagcatcaaggtactcaatggtcgaggtgagatcaggttccctcctagtcttccttaaactttctcaatttcagagttgtcgatgaaactggagaaggaccgcgaaatgttgaagaattgaaattgcagagggatgacgccacgtctatatctagatccaatgattttagggattcgatttcggacgctacaagtctgccgatggactcgatgagctctccagtggccaagaaacggaataagaggaatacggtaagggttttatgagttataactaaactctaaaagtttaaaaattctacaggaatgcgcagtttgtcaatgtgatttaccaatgggcaataccgccgagttcaaggcagatggtacagcgcaaaccgacttggcacagttccagatcgatgaaatcgcgattaaactcgctaatttacaggtaacctctatagaaactattttggaaaagaaaacatatttccga