Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_245.f   

sjj_Y47G6A_245.f RNAi JA:Y47G6A_245.f
Simmer:Y47G6A_245.f:Repeat_b
Simmer:Y47G6A_245.f:Screen_A
Simmer:Y47G6A_245.f:Screen_B
PCR_productsjj_Y47G6A_245.f
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y47G6A.20a Source_evidenceePCR661WS150 Sequence/Annotation Release
Y47G6A.20b Source_evidenceePCR661WS150 Sequence/Annotation Release
Y47G6A.20c Source_evidenceePCR661WS150 Sequence/Annotation Release
Overlaps_Gene Y47G6A.20 Source_evidenceePCR661WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Max_abs_score598Y47G6A.20
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI35443613546663
Overlaps_transcript Y47G6A.20a Source_evidenceePCR661WS150 Sequence/Annotation Release
Y47G6A.20b Source_evidenceePCR661WS150 Sequence/Annotation Release
Y47G6A.20c Source_evidenceePCR661WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_245.f2303tttttcctagattcaaaggggaggaaatttttaaaaaatcttactctcaaatattgtcctcccaaatcgaacatattcattccagcgatagcctcactttgcgacgtcaaattattgaattcgaggtatccaaatccacgatgtccccgtcctgtgggagcacgagccagctgacattttacaatttctccgaacgcttcgaatacacttttcaggtcggtctctgataaatccggatgaactgaggacacgtagactctgaaaaaaaaaataaattttgcggggatttttaaaaaataatacgattaaaggtggactacgctcagtggggaaattgctttaaaacacgcctatggggtcacaatgaccgaatatcatgattaaaaaattcaaaaaaatgttctagattttatatgattttttgaaaattggaaaaatcagttttcccctctaattattttgaattaccgccaattggatttgaccgatggagggcacttgcaatattttaatcaattaattttatttattctcgttatttgactgattttcttcattttctatgttttttccacggaaaatgggagaaaaaacgagacaaatgcgaaatgattgttaaaaagtaattgaaaatgagtaaaactgtgataatttgagttccgacgacaacaagcctgaaattagtatatttcacagttttactcattttcaattactttttaacaagcattttgcatttgtcttgtttatttcttccattttccgaggaaaaaacatagaaaatgaagaaaatcagtcaaataacgaaaataaataaaattaataaataaaaataatgcaagcacgctccaccgaacaaatccaattggcggaaattcagaaataaataggtgaaaactgtgatttttccaattttcaaaaaatcatataaaatctagaacatttttttgaattttttaatcatgatattcggttattgtgggaccataggcgtgttttaaagcgtggtccacctttaaattgtgtttttttttcaaattttgaaatacttttccgaaacaaaaattataaataactattaaattgtcgatttttaggcaaattttgaaatttccgccactttcgggtaatcgaattttattcacggataagtgtctgaaaaatctgaaaaactgacaaaccaagtaaaccgatgtttttagcccgaaaacgccaaaatatcgaaaataactttgcgcgggaattcaaatttaattcggacgtttctttgatttttgaaaattgaaaaaataataaaaaatttagaaacttttttaaccagttatattcggtctctacttttttctgtcatttaaagcaccaaattttttaaatgactttaaataaaataattaaactagtaatttctcattttacctgaaatatttcttcgcatccttctgaaccatatcaataatcggctgagcctgtggcatattttgtggcaatctcatctcctggaacatcatcgaattaactttaagattacgtccaccgagcatctgaccattcatcgattcttgagcaagaagtgcggcttctgggacttcgtattcaacaaatgcgaacgttttgtggtgctgaaaatgaaatatttattaatttaagactaaaaatatgctcaattcgtaataaaacttccgtttaaaacatcaaatatttgaaaaaaaagtgtcacagcttttggaaattaatttttattcgattatcattttttttattgcatatttttatttaagttgttcatttaagtaaatttaaagccaatagatgacaaaaaatgaccaaaaattggatagaaattgagataaactatcaaaatctgcaataaaagatgaaaatcgaatgaaaaataatttccagctgctctgacacggaaacttctggtaaaataaaggaccttagataaaattagcttaattctttcggaattttaaaataaaataagacttttttaaaaactcaccccagtagctggatcccagctcatattaatagatttaatgggtccaaatgggtcaaaagccctgcgaagcatatcttcgcggatttcaaatgagattgagccaacatagattctggacataatcgataaagcttgtgagtacatttgctgccgttgttgctgaaattttattgattattacgataatttctactttttaaaaataaaactaacattctcctgttgctgtttctgctgacgaagaagaatctgcttaattgaaatgtccatcgcatactttttcgccatctgaatatca