Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_245.i   

sjj_Y47G6A_245.iRNAiJA:Y47G6A_245.i
PCR_productsjj_Y47G6A_245.i
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47G6A.4 Source_evidenceePCR1071WS150 Sequence/Annotation Release
Overlaps_Gene Y47G6A.4 Source_evidenceePCR1071WS150 Sequence/Annotation Release
Chunk_score Abs_score946
Max_abs_score946Y47G6A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI35494583551849
Overlaps_transcriptY47G6A.4 Source_evidenceePCR1071WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_245.i2392tcgaaaagttgtggaaagttgtttgaaacttctcaaaaattgtcaaaattttgcaatagtgtcgaaagttgtcgaaacttatcgaatgttgccgaaaaattgccaaaaaaatgctataaatggtcagtagcttaaaattttcagccgacgaactgggaatttcgcccaatggacccgccgatggctgtgaaccatatgaagttttcgagtggcttcaacaccttttaaaacagcatccgaaatctccgattctatgcgatcgagctcaattcaattttgtatattatggaatcaagactctggccacttacactggaatcaatgccatcacattcttccaagaagtcatcattcctagtattctgagcattcaggattttacaagtgtaatactcgaaaaagcgccgacggatgtcccccgtgtctggagagatgttgatatttgtaatcaatttcaatatcattttctcattcccagaactgaattgaacctattctgcagttttcatgagaataaaccatcgcctacgaaatacaattgcgtcaaggctcataatgcaagactattgtaacattttttgcagtgattttcaagataaaacacattttacagagacaattttttcactgtaataaaggggaaccggcttcaaggattcgtgatttcgccgccagttcatgagatttgcattcaagacgggagtgacacaagtttgcctcaaacgtacggaaaaacgaaaattttcgatttttcgattatccgaaaatacaaaaatgtaaaaaataagttcagaaaattaaccataaaaaagtttaaattgatcagaaaaaaacataaaaatttattctaaaaagaagaaaataccaaaaattataagctaatttttgacaaatcgaaaaaactaaaaattttcgatatctcgatttcaaaaaaaatcgaaaattttcgatttttcgattatccggaaaatcggagaaaaaatctgaaaattaaccataaaagatgatttttttgaatctaatttcgtctaaattggtgagaaaaaaacatacaaaaaatgtattctaaaaataagaaaaaaaaccataatgaccaaaagtcggttttttctaaaattttcgtttttttatttttccgatttttcgatatttttgagggaaaatcgaaaaattggaaatcgaaaacagaaatttttgatttttcgttttttttttcaaaaatagaaaaatcaaaatttttttgattttcgatttttaaaaaaaaaatcatgagaaaaaacataaaaatttattctaaaaagaagaaatgttttcgaaaaagaaaattttcgattttaaattttttccgaaaaaccttttttttttaaatccagaaaaattaaccataaattatgattttttaaaaatttaatttggtctaaattgatgagaaaaaacataaaattttattctaaaaagaagaaaaaataccaaaatgaccagaagtcgatttttcaaaaatcgaaaaaatttatgtttttccatttttcgatgtttttgagggaaaatcaaaaaatcgaactacgaaattttttcgatttttcgttttttttttcaaaaatagtaaaattaaaattcacagaaaaaacaaaacattctctgcagttcccagaaatttcgaaaattaaatgagcgtctatagatatttttccagaatcttggcaagaacaatatcccgtaatgacgccgaagtctacgccgccaggcagagagataccgatgaacaatatgacgtccatcaagaaggtccatctaatcatgatcaatacgaattcgcatctgaaccactggatttcgaagaagattctgatgaggaaaactacaatgaacagcttgatgttccttattcttacagtaagaatttttctcgaaaattctgaattttgaaagtttgaaaattaattttttttttatttttaatttcagacgatcacttcatcagctcatcatctgttcgtgagccagagcatcccagtgcaagatcaagagatgttgctccaaatgttcaacaagaatctgttgtggttccggctccaaggcgattgtcgccacagcgagctccacgcccgtcacaaaatagtccgaatgcttattctgaacgcaaaaggttcgtcgtaaattaaagaaaataaattttttttaattttcagtttttccgcgtttccatccgaagatccatctgaagattatgaaaccccaataatcagtcatatcatgaatcgaaacgaagcggatcaatatttcaatattctggattcggtgaaaccgggacagaaatataagatgtaagtgtatataataaaaaatttttaatagtttttatattatttcagaatcaagttcgacgacttct