Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_247.g   

sjj_Y47G6A_247.g RNAi JA:Y47G6A_247.g
Simmer:Y47G6A_247.g:Screen_A
Simmer:Y47G6A_247.g:Screen_B
PCR_productsjj_Y47G6A_247.g
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47G6A.10 Source_evidenceePCR1255WS150 Sequence/Annotation Release
Overlaps_Gene Y47G6A.10 Source_evidenceePCR1255WS150 Sequence/Annotation Release
Chunk_score Abs_score1194
Max_abs_score1194Y47G6A.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI34704373472672
Overlaps_transcriptY47G6A.10 Source_evidenceePCR1255WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_247.g2236caatttagctgatttctcgcactaaaattcttttaaaattctgatttttctgattttctgcactaaaaatttgaaaaaatccaatttttcaggcatttttacattaaaactcccccaaacttcaattaaaaacctttttttttcagcaaacgcgaaatcccaaacctcatcagcgtcgcattccctcttctcttcggctattacatctatcgaatgctgaaaggcggtggagcagctggcggagccggaagagctggtggaggtggactcggtggaatgtttggtggattcggacaaagcacggctagagtcattaatcgagaagatatcaaggtgaagttcgccgatgttgccggttgtgaagaggcaaaaatcgaaattatggagtttgtgaatttcctgaagaacccccagcagtacaaggatcttggcgcgaaaattccgaaaggagccattctaacaggacctcctggaaccggaaagacacttctcgcgaaggcaaccgccggcgaggcaaatgttccattcatcactgtatcgggatccgaattcctggaaatgttcgtcggagtaggacctgcaagagtccgtgacatgttctcaatggctagaaagaactctccgtgcattctatttattgatgaaattgacgcagttggaagaaaacgtggtggaaaaggtggaatgggtggacactctgaacaagagaatactctgaatcagcttctcgttgagatggatggattcacaactgatgaatcgtcggtcattgtgattgccgccacgaatcgtgtggatattctcgattcggcactcctccgacctggtcgctttgatagacagatctatgttccagttccagatatcaaaggtcgtgcttcaatctttagagttcatcttggaccacttcggacttccctcgacaagactgtgctttcacgaaaactcgccgcccatacaccaggattctctggagccgacatttcgaatgtgtgcaatgaggctgcgctgattgcggcgagagatgcgaatcacgagatttcaaataaacatttcgaacaagccatcgaacgagtcgtcgctggaatggagaagaagacgcaggttttgcagaaagaggagaagaagactgtagcctatcatgaagctgggcatgctattgctggatggttcctacagcatgcggatcctctgttgaaggtttctattattccacgaggaaagggtctcggatatgcacagtatttgccgaaggagcaatacttgtattcaaaggatcagttgcttgatcggtaatgatgatgcagtttttaagtttttatttttcaaaaaaatttccaagaaaaaactgttaaaaactgtcaaaatcgcgattggaaacactttaaaatcgtgatttctggatatttatagtatcaaaaagtgcttttatgagattttcccgacaatattacacttattgcttgatcgtagttacaaattgtgcaaaatcgtgatttctggaattttttgaatcacgaaaacgtgatttttaagcaaaaaggtccccaaaatttcacttttatgaagctttggcggcggatatgcactctaaaattttttaatttaattttttttaatcataattttgaaccaggaataagtcgacattagttcgaaatttaaaaaaaaagctcaaacaaataggaaaaaagctaatttaactttttctccccaaataataaaaatcttaatattttattcagagaattgaattttttcgaaaatttttaatctttcccttcatttaggatgttttcccaaaagatttcactgtactgataaatttttagctgaaatttttcaattcaaaatcaatatttctgatttttttcaattatgcatatttcaaaaaatattgtttttttttcgattttgcgattttttaccaaaaaaagagccaaattttgttggcaaaagaaaacctttaatttttcgatatttttcaaaatttttaaaaatttttcagaatgtgcatgacactcggaggtcgcgtcgccgaggagatcttcttcggacgaatcacaactggagcacaagatgatctacagaaagttacacaaatggcatattcacaggtttggtttattttattttacagctttattgagacggagcaaaagttgcaaaaagtattcgaatttaatctaaaaccggcgatttcttgtcgagagcctctgtcaatccttcacaaatc