Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_247.i   

sjj_Y47G6A_247.i RNAi JA:Y47G6A_247.i
Simmer:Y47G6A_247.i:Screen_A
Simmer:Y47G6A_247.i:Screen_B
PCR_productsjj_Y47G6A_247.i
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47G6A.8 Source_evidenceePCR1034WS150 Sequence/Annotation Release
Overlaps_Gene Y47G6A.8 Source_evidenceePCR1152WS150 Sequence/Annotation Release
Chunk_score Abs_score1089
Max_abs_score1089Y47G6A.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI34824903484588
Overlaps_transcriptY47G6A.8 Source_evidenceePCR1152WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_247.i2099tctaccaattcctcattgctgttcgtcaagatggttcccagcttcaaagtgaagatggagaaaccacaagtcacttgatgggaatgctgaatcgtacggttcgaatgttcgagaacggagtgaagcctgtctacgttttcgacggaaaaccaccggatatgaagggtggagagcttgaaaaacgttccgagcgtcgtgctgaagcagaaaaagcgctgactgaggccaaggagaagggagatgttaaggaagcggagaagttcgagagaagactcgtaaaagtcacaaaacaacagaacgacgaggcgaagcgtttgctgggattaatgggaattccagttgtcgaggctccatgcgaggcagaagctcagtgtgctcatctcgtgaaagctggaaaagtattcggaactgtcactgaggatatggacgcgctgaccttcggctccacggttcttctcagacatttcctggctccagtcgccaagaaaatcccgatcaaggagttcaatctttctttggctctcgaagaaatgaagctaagcgttgaggaatttattgatttgtgtattcttctcggctgtgactattgtggaactattcgaggcgtcgggcctaagaaggctgttgagctgatcagacagcacaagaatattgagacgattcttgagaatatcgatcaaaatgttcgtcgttcgtaaaatgcctattttattataaacgcgctccacggcaaataaatgccccgaaccatgggtctcgttaggtacttgccggtgaaatcataaattcgaatttttcacttagttttgcctttttttttaaattaattttggcatgaaaatcaatggaaacaactaaaaaagccgaaaaattcaataaaaaattagcaaattttgaacttacggttttgccgccaaatagctaacgaggcccattatgcgtgcaagcgtaatttttcgagaaaaaaaaaatcgaatttccaatattttcctgtcatttttcaatttattggagaaaaattattttatttttctcatcaaactttaaaaaaagctatattgtttctcctaaagatttattattgaaaaaattatgaatttgttcgtttttcgattttttctctgaaaaaaactcgaaaaattgaaaaaaaataaatcgaaagttttcaatgttttttgtgaaaaaactgacaaaaaaaagcggaaattttcagttttgtctaaaaaaatcgaaaaatttcaatttcctactagaaaaaaccgaaaaatggaaaattttcttttttctcttaaaaaaaatcgaaaaatttcactttccttctagaaaaaaaccgaaaaatcggaattttttaaacaacacttttggctcgaaagcggagccttttgaattagcagtggagcgcgttaacacatcgatttcaaattggatttttctgcggatctataatatatctaatttctaaaaaaaattccagaaatacccaccaccagaggattggccatacaagcgtgctcgtgagcttttcctcaatccagaagtgacaaaaccggaagaagttgaactgacatggaaggaagccgatgtcgaaggtgtcattcagttcttgtgcggagagaagaacttcaagtttgtccccatgaacctcatgaacttcatctaatttttctttcatttccagtgaggagcgcatccgaaacgcgttggcaaaactgaagactagccgtaaatctggaacacaaggacgaattgactcgttcttcggaaactcgaccaaggttacatgtgtgacagctgcgacaaaacgaaaggcggaggaagctgagaaggcgaagaagggagcaaagaagggtggaccaccgaagaagagagccaagtagctcacactaactattcaatttcttatttgatttttgtgaaatattgattgaaacgaaataaggtttttatttacctttatcctttttttaatggaacacacaaagctaagaaaacaataaaaaatttggaaattttcaattccgtcaatttgccgatttgcccaacacccatttgctggaagttttcagggttttttataagactgaccaatttgggaaatt