Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48A6C.4   

sjj_Y48A6C.4 RNAi JA:Y48A6C.4
Simmer:Y48A6C.4
PCR_productsjj_Y48A6C.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48A6C.4 Source_evidenceePCR736WS150 Sequence/Annotation Release
Overlaps_Gene Y48A6C.4 Source_evidenceePCR736WS150 Sequence/Annotation Release
Chunk_score Abs_score631
Max_abs_score631Y48A6C.4
Specificity_index0.895
Rel_score1
Map_statusUnique_ePCRIII1111961811121256
Y48A6C.1 Chunk_score Abs_score74
Specificity_index0.105
Rel_score0.117
Overlaps_transcriptY48A6C.4 Source_evidenceePCR736WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48A6C.41639ccattttcgcatttttcttgttattctctcaagaaacacgcgaaaattaacattttttgcagatggtgaccaaaaagaaggcacggaaaaacgaagatttcaaaaaagtcaagctgaaggtgggaaaaaagctgaaaaaaacgacgaccaccgacacgactatcaaaggtgagttttcacccgattttcgcgaattttaattcattttttcagcaaaacgagtagtattggcgactcagttggaggaaaaagtggaaacagatgataatccacttagtttccgtggtctaacgctcgatgagctctgcaagcagatggggcactttaatgcggtaatttttcgctgaatatcgatcaaaattaataaattctcgttcagaaagtgaaaatgaacgctattcaaggactaaaacagattttaacgtctcgcccggatcttgtcaacgtccagttgaggcttttggttccctgcgtggctgtgcacgtggctgacgcttctttcgagccctccacacgtcagaatctactgaatctctacaaaattctgtgtacagcttcaattcaagcaatgtcggctcatatcacacttttcctgtcccacgtgctccgcgctctaacgaatatcgtcacagagtgagtggattttttctgaaaaatgggaaattttgaattttcagagtccgccacctcgcactgagcacactttcggtgcttctcgatcgatatccgagcctttgccggaatcatgccgatctcttcccctgttttatcaattatctgggcagttcgaagcgtctggcgtggaataagccgggattaatcgatacaattctcaatttcatcaatgttcgtagttttttgcctggaaattgcgaaaaattcactagaaattcgagaaaatcgattttaaactgcatttttatgtgtggtcctggaaaacacaaaaaaaccagaaaaaaatgaagaaaaatcgataaaaaatccgattttgcagcaagaatcagagcaaaattgcaattttgcgctgaaaaaacttaaaaaatggattaaattctgtatctttcggtaaaaatcttggaagttgactgaaaatccgaaaaataaatttttaaacttgaactttctgtttaaaacacaaattttcgactgaaaactagtgaaaaattcaaattttgtggttaaaaaagctgaaaactcagcgatttcccagaaaattgatatttttcagtaaaaatcttagaagttggctgaaaatccgaaaaatacattttttaaattgcaattttcagttgaaaactccaaaaaattactaaaaaccacaaaattttgaccgaaacctgttaaaaatggcaattttattgtaaaaaagctgaaaattcactggcatctagttttttttcagaaaaaatactgaaaattgacgaaatttgcagttttttcagtgaaaatctggaaaaaatgcacgaaatctcgtaattatttcatttaaaagcttgaaaattcgctgaaaactctaaaaaacttcgaaaaaatattttttttttctttcagatttacgatataaatcgagaacgacacgtggatccttccaccctggaaatccgattcgaaaatgagaaaatcgagggaaaaagtgatt