Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48B6A.2   

sjj_Y48B6A.2 RNAi JA:Y48B6A.2
Simmer:Y48B6A.2
PCR_productsjj_Y48B6A.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y48B6A.2 (3)
Overlaps_transcript Y48B6A.2.2 Source_evidenceePCR348WS150 Sequence/Annotation Release
Y48B6A.2.1 Source_evidenceePCR358WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48B6A.2763ttcatggcttcaaaacttcaaatatccttaattttcttcttttttttgctgctttggcggtcagttgaaaaataatgttactttttcttctcgtcttcttaccgtttctacatttcttaactttgaagtatgaatatatgtcctttacatagaatttagattgttggtagaaattctgctggaaatttcgtattttttcgaaacactttcgcactaggctgaatcggttaacttgtttattactttattcctcgttaacacatttcacctttcttaatccttctatctcgcttccaaaaatgcagttggctttattggtttatattttcgatttttcaatgctccgtcgctcaaaattatgtctattaattacttctgtttttgcaaaccactcatttctttttttcaggtaatccagtcgaaatggccaagagaactaagaaggtcggaatcgtcggaaagtacggaacccgttatggtgcttccctccgtaagatggccaagaagctcgaagtcgcacagcactcccgctacacctgctcgttctgcggaaaggaggccatgaagcgaaaggccaccggaatctggaactgtgccaagtgccacaaggtcgtcgccggaggagcctacgtctacggaaccgtcaccgccgctaccgtcagatccaccatcagaagactgagagatcttaaggaataattatccttttgaatgttgttaatttttcacatataaatatgtgttctacattcgcctttttgtt