Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y48E1B.10_b   

sjj_Y48E1B.10_bSequenceCCGCCATATCCAATTACAAATAA
Length23
In_sequenceSUPERLINK_CB_II
PCR_productsjj_Y48E1B.10