Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48G1A_54.d   

sjj_Y48G1A_54.d RNAi JA:Y48G1A_54.d
Simmer:Y48G1A_54.d:Screen_A
Simmer:Y48G1A_54.d:Screen_B
PCR_productsjj_Y48G1A_54.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48G1A.4 Source_evidenceePCR1398WS150 Sequence/Annotation Release
Overlaps_Gene Y48G1A.4 Source_evidenceePCR1398WS150 Sequence/Annotation Release
Chunk_score Abs_score1293
Max_abs_score1293Y48G1A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI323867326080
Overlaps_transcriptY48G1A.4 Source_evidenceePCR1398WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48G1A_54.d2214gttgataaaaagcaaaagcaacgaaaaaccaatccattcgagctaaaattcaacaaatccaagcatgacgtgagtttttcagagttttgaagaaaaaatcgattttctcgcagattctcggccggaaaaagggcgcacaagttggagcaccgactgcgtcacgaaaacgagctcacgagcaacgtgaacagacgctaggcgtagaatatgaccggaaaaataagattagcaaaattgtcgacaaacggctcggcgaaaaggacggaaaaagcgaggaggagaagggcgcgatgagattcacagaggaaagagtcaaaaattataaaagagcatcgaaattcaacttgacagatgatggagatgaggaggaagaaggtttattccgaaataaattgagaaaaattttaataaagtaaatttcagtacttactcacaagggaaaagcgctctcggacattgaaaaatacgacaaatcgatgatttccgactcggatgacgatgaagagccgggaaatttgggctcaaatatggtaaaagtggctcatttcggtggtggagagaagaccgccgaggagcacgtccgcgaaaaaatcagccgagaggatatgatttcgaatttgattgcgaaaacgaagctggcgcgtcacgagaagcaacagcagaaggatgagctcgagctgatgacagagtcgttggattccaagtatcaggctttgatgggcaaaatgaaggcttcatttaggccgaccgggcgccagccgctggaaaaagatgattacgacaaattggtacgggaaacatcccggttttctccaaatttttaagataaaagataattataaatttagagtgaaaatcgatttttttcacaattttttagtggaaaacctaaaacccaaaaaacttgatctgaaaatgctaatttttaaccatttttgctatggaaattggaaattttcattaattttgctgtaaaagttgaagaaatccaagttttagctttgtaatcagagaaaacactgtaaaattatttcggaatttgtgcaatttgaagtgaaaaataaaacatttaacttcttatcgcgaaagaaattgagctgaactgagaatttttttgacgaaaaatcattaaaaagtcaatttttttgacaaaaattcgagaaaagtcggtttttcttttgacaaaaatgacgaaaaaggcaatttttaatttaaaaaaataaatttttcgccgaaaaataactttaaaaaagtcgtttttttacaaaataaaacaatttaaaataactatttttcgacaaaaaaattaagaaaaagccaatttttttgtttaaaaaatgatagaaaaaggctttttttttgtttcttcgcctaaaaaatcaagaaaaataggttttattccattttttatccaaaaattattatttttccagacaatcaccttgaaaaccgaagccgacgctcgtgccaccccagcagatcgtaagctatccgaagaagaagaagctctgaaagaaaaagaacgtctggaaactctcgaggccgcccgtatctcgaaaaataatgcatttttcaacgcaaaatctcatttatcagccgatgccgacgttgatatcgatgctggatcgaaggccgacgccagaaaagttcaggcgaaaaattcgagatttgaggtcaaatttgacgatgaaggtggcctgatcgatgaggatacggtggaaaaatccaggattttaaagaaaaatctggatggttctgatgaatctgacgatgacgaggatctagaagatgaggaagaggatctggatgatctactggaagatgaggatgagctggaagaagattccgatgatgaggaagctcaggaagcccaaaaagtcgtcaaaaaagcgaaaaaatctgctccagaacccgctgaaactctgccattcgtattcgaaatgccgaaaaactataaaaaattctgtgctcttctggaaaaacactcggaatcgatggatttagtgctggaacgactcgtgaaatgtcatcatccgagccttaaagaaggaaataagaagcgtctgaataagcttttcctcttgtgtttaagatggtttgatgatatgtcgaaggaggaattgacagcggaaagtgtgaaggaaatgaatttagcgcaggaaactatgcatgcgttgatgaaggtagcgattggatggaaaagctgaaaaatta