Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48G1B_55.a   

sjj_Y48G1B_55.aRNAiJA:Y48G1B_55.a
PCR_productsjj_Y48G1B_55.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48G1C.11 Source_evidenceePCR843WS150 Sequence/Annotation Release
Overlaps_Gene Y48G1C.11 Source_evidenceePCR843WS150 Sequence/Annotation Release
Chunk_score Abs_score738
Max_abs_score738Y48G1C.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI8669289139
Overlaps_transcriptY48G1C.11 Source_evidenceePCR843WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48G1B_55.a2448aaagaagttcgatctactcggctacgatttacagtttcccttactgatttctactaaaatgcattaatcttgagtttatctctaacaaattgatggtacttttgaatggttataacaccggatattttgcagaagacgaaggatcagatatgtcgattattgtggccagcctcacgcaaatgtgctgtgatccattttacagaacaactacgggtgagtttattaaatgttttttctgtactaaaaatggggtttaaaaaactaattttaatttagttctctccttgtattaatttccaaaattttccgaaatttttttttcaatttaaaaatcaatttcaggtcttcaacaactcatcgaaaaaatgtggattgcccttggccacccatttggtgaacggctactcggaagaaccgacgatgatccatcgagacgtggaaaaccacagaataaaatgagaactgacgtcatgccgacgtggttgctcttcttggattgtgtttcacagctacatcgaatatatacatttgagtaggtttggtaaaaaaaatgttttcccccgcaaaaaaatgttttcctcaaaaaatttgaatttcccacccaaaatttttctcaaaaatttttttaaaaattaattttaaaattgttttctcaaaaaatttgaatctcccggatttaaaaattccaaaaattcgtctatcaataaattttatattgttttcgaatttcgaatcataaaaattagtttcaagttaacacaccttttttttcaaataatttttttaaaaaataattttaaaaacaattaatttttttcctatttccagattcacattctctccacacgttctcattgcactatgggatctttcattaactggaatggttccatcaatggcttgtaataatctggaagagcaattactcgcaaaagtcggcggtggaccattcccattggatcgatattttgagaaaagctactcgaaattatttggaaatatttggcacgacgcagtgctttttatggaatctattaagaaaagttggtgctttttaagaaaaaaattttatatcgattgttcttttctttttgatttcagctactttttcacctcggtcagcaacatttttttgcaacattttggacgtggccgcgaaaaaaaaattggtggccgagttttcttttttttcactgccattaatttccgagaggaaaatctaggaattaaaattttttcgaaagtatacaatgttgaccgagaaaaaatcggtggccgaattttctctttcttctctgccacgttattttagtaaaaaattagaaaaaaaaacacaaaatgttgttcaaattttggaaaaagtctgtaaaaacaacaaaaaattgatggccgagttttttttccattttcgcggccacgtgacaagcagtgatttctcaaatgttttcaggaaaaaaaaacaggcggaattcagataattctacgaaaactatttttgtttctggaaaaaagtcaaaacttgaaaatcggtggtcgagtgttctctttttttgcggccttatctcgatttttccagatcaaccagtgtgtgctcactcgaaattccttcaatgtgaatttattcggccaccgacgtcgttttgcgatattcaactgtggtccgagtgctatcttcgatggattcctccggcaaacgggaaaaattcgggaaaactcggcgaagaactctcgctggacgagaaaatgatcgaaatggccaaaaaatggaacagttccgagtggaaaatgcatttggacctaccggaagaggtgaccaaacttttcggatttataggctctaaacatatttttactttcaattcttaaatttttagtattcatctgcatatccttactcgattccggagatttcccgcccaataatggatttaaatgattttgatatgatccggccggatgatttcgacgcaatgtccatgaattcatccatcaactcatattcgttcgttaatacggtagggatacttattagctcggaaaataaattacgacatattttgtctcgaattttttataggtgacttataatagacatttagtgtctaggcacacataaaagttagatctttttcagctatcgtttcgatactttcacacaaaagtaggttttttttcgcaactttgtaaattgaaaaatcaataggtcggcaaataattgttggcgtattttgtcaattcacgatatttatcaaaaattttatatgtgacttctggtagaaatttattatggttggcaataagtactgagtcaaaattcatataacttgttttgttgcttatcgattttttttaattgccggagttcatgttattaactatgggctttcatctgaaagtagtcacaaaacattttaaaaactcgaagtgatccaagtcgaaacaactttt