Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y50E8.q   

sjj_Y50E8.q RNAi (5)
PCR_productsjj_Y50E8.q
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY50E8A.12 Source_evidenceePCR552WS150 Sequence/Annotation Release
Overlaps_Gene Y50E8A.12 Source_evidenceePCR552WS150 Sequence/Annotation Release
Chunk_score Abs_score468
Max_abs_score468Y50E8A.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1478508914786693
Overlaps_transcriptY50E8A.12 Source_evidenceePCR552WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y50E8.q1605caaccacaaacaccactttctttaaaacttcacagatttacttattaatgtctgaagctccacaacagctcaaaaaccgctcctcagccgggtcccattctagaaaaaaattcgtcttgaagtaatagaaacagtatacaagaaaaaatagttacgttgccaataattataaattcatttcaacacaatacaaatcaaatattaaaaaataaattaatcaagttcttctttaatctcatgcttccgtctagcttcatctgcctcttccattgtcttttttacatgaagaaaaatggttttcatcaggaaagtcatcgaattcggatccaattctccacctctacccttcaaatcactcattattttcagacgtttagcagggatctgaaaattacataggttttgaaaaactttcgacgaaaattaccggttcctctgatgagtcgtctggcacaaatgatgaagtgcttctgagatccacgtgtcggatgaaagtagcgtttttctgcaattaaatatcggaattaattttatttttatatttttctcagatttttagaactaacgatattcaagttaaagtcaaagttgtgaaaactaggccacgtaaatcgataagcctatgtcgatttacgagccatgtcttttgctgttggcataagctcacatggcatgcttttcgatcttgaaatggaagagaaacgatgacgaaaataaaaactaggccatcattgtttggctcctctagacatgttatttttgtagatttacgagcaatcatgagataatcaatattttcgtataattttcgagtttcaatagattttactcttacaacagggaaaatttcagaaatttgggcgttttgaaacaaagtgccttttcctcgtgaagtacacagcgaaatgtcaaccgagtgtgtttaacaagtcacttttttttcaatattccattataatctggaattttacaaacaatattctcgcaaaaactactaaaatcacataaattcacgaataaattgattcttttattgcggaatcgctcgtaaatctacattctgaacggactagctggcctagttcttcacattcaatcgtatatctcttccatctcaaaatattccagtgaacgaataactaacaaatgccatcgggttcctgttccggatcaattcaaatccgtcgtcagtcttcctttgtgcaaaatactgcctgtcgaaatgatcgtagcagatgtattttctgccagtcgccaatgaagccttcaactgatcttcgaatcctgcgtctccattcgccaacacagtcacccattgttctctgaaaatgtcaagctttagaattccaaaacttcttgcgctgaaaaagaaacttactgtttgtctggaactcttgtgaaagaagtgacgtagctgttaagcgtcgaggatccacaaacgacacaagttcgacgtcgaatcgaaacagtcggtgattgcacagaagaagcttcggagagcattgcaaatcaccaaaactggaggaatgagcagagggaatgaatttttaccgtacttttctgccacacatgacacgtgggattgttcagatgaccttacgaggt