Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y51H7B_5.b   

sjj_Y51H7B_5.b RNAi (6)
PCR_productsjj_Y51H7B_5.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY51H7BR.8 Source_evidenceePCR165WS150 Sequence/Annotation Release
Overlaps_Gene Y51H7BR.8 Source_evidenceePCR165WS150 Sequence/Annotation Release
Chunk_score Abs_score123
Max_abs_score123Y51H7BR.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII15193641520465
Overlaps_transcriptY51H7BR.8 Source_evidenceePCR165WS150 Sequence/Annotation Release
Overlaps_pseudogeneY51H7BR.6 Source_evidenceePCR76WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y51H7B_5.b1102gtacctgttatattggctgctggaataaataatgatagaacaggttggttttagggggacaattggacaaaaggcaaaaaaaaatatttttataaatttatttctaactttaaacttgtataactttcctctcattcaagttattcaaaaattttgaactgacaaagttattaaatattttttgatataaaaaaattttcaaatgtaaaataacaagattcatagaaaagttataaacgtttaaactaaaaatgccaaaataaatttttttgaaaaatgttttaattttcaacttgtataacttttttcctgtgtaagttattttaaagttgtcaactaacaaaaaaattatgaaacaatgttttataatttgacaatttaaacattattttagcttattactgaaaagttataaatgtttgaacaaaacaatcaaatttttaaaatcaataacctttaactggtgtaacttttttcggtgtagtgtaatcaaaaagttatcaactaacaatatatttcaaaacatgtgtagatcattttgttagttgacaactttttgatatcttcaaagatgacagagatattcgcttagtagtagcaacatagtgggaagcctcccccaccctctgcgcctgccccactctcctctacgcccatgaagctgcttcacagcccgtgcagtcatgtccgagtggttaaggagattgactagaaatcaattgggctctgcccgcgtaggttcgaatcctgctgactgcgtaaaaatttttcgaaaaaataaaaaaaaatcgaatttccaggtctgctccgcccgttccgagaaattcagcagagaggcatattgcttggagaaatcgatgatgatttattggacttattttatgaaagatgtcatgccgagagaatgacctacaatccataatttgcttcaaaaatttttttaattgggaaataaaaattctgaaattttttttgattaaaaaaatttaaaaaaattgaaaaaaaaatctaagaattattttcaattcactttttcgtaaaaaccggatgattccaataaaaatagcattacacgatatttacacggcaatcgataaaaagt