Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y52B11A.2   

sjj_Y52B11A.2RNAiJA:Y52B11A.2
PCR_productsjj_Y52B11A.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y52B11A.2a Source_evidenceePCR657WS150 Sequence/Annotation Release
Y52B11A.2b Source_evidenceePCR306WS150 Sequence/Annotation Release
Overlaps_Gene Y52B11A.2 Source_evidenceePCR657WS150 Sequence/Annotation Release
Chunk_score Abs_score594
Max_abs_score594Y52B11A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1096813310970261
Overlaps_transcript Y52B11A.2a Source_evidenceePCR657WS150 Sequence/Annotation Release
Y52B11A.2b Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y52B11A.22129ttaccatcacattatccgctttcattcgatccatgagctctaacattttcgaacttgctccaaattccccatcatccacacaatcatgatgatgaattggttttccattgatttcagtcatatatcgatatgctgtaatattatgtgttgcccggcagatttttgtattcgatttaaggattcgcatcactcgatccacctggaaaaaatggaaattatgactacaaactacaaaaaaaattgtgaaatttcagaattttaaaagtaaaatttccattttcacagcttttttttaaatatcaaattcaaattttttaatttataagcctttataggctaaggctaagacttccacgtggaaaactttcttggttgaggctatagaatattgtagtttgtagtgtggttgaggcttacatcttccttactccgaacctcggccaaatgagcctgaaatgcacttttccggtctgtaagcacttctccgtgtcgaatattcatatcatcgatttcctcggccatcggtgtcaccacgtcatcggccacatggctgggctccgctacttcttcgggaagatcctaaaactattttaaacttcttttttttcgcgtgttttcggtaaaaacctacccgaataaagtcttgaacaagggatatccaattgaaaatcactggaaatccgatattttcgatataaacgtcatttagactgttgtgaagcacctctttctgctcccgacggagatatggaccacttagttcgaaaattggcggagatctggaaaaaattggtgaaatacgagaaaaaacgtgttttttgcatgtttttttttgaagaaaaacgaagaaaaagtacgaattttaagtttggttgaggctcagcgactacaaactacaaaacgctctgagcctcacccaaaactgaattttatcgtttttactcaactttcaccggattttttatagttgcggttcattttgtttaaaaattggtgaaatatggagaaaaaactatgtttttacgcttttttcgaacaaaaacgaagtaaattgacgattttttattttggttgaggctcacggactacaaactactaagcgctctcaaccaatgtgattttttgcgattttttaatcttaatttcaagaattttgcatgaaaaaattaggaaatctgttattctcaatattttaaccgaataaaatggtaaaattcagtttttagagcaaaaattggtaaatttccagttggttgaggttcagtgactacaaactacaaaacgctctgagcctcacccaaaactgaatttcatcgtttttgctcaatttttaccgttgctgttcatttaattcaaaattggtgaaatatggagagaaaactaggtttttacgcttttttctaacaaaaacgaagtaaattgacgattttttattttggttgaggctcaccgactacaaactacaaaacgctctgcctcacccaaaactgaatttcatcgttttttatcaattttcaccggattttttattgttgccgttcattatgttcaaaaattgataaaatataaagagaaaactatgtttttttctaacaaaaacgaagtaaattgacgatttttattttggttgaggctcacggactacaaactacaaaacgctctgagcctcaatcaatgtgatttttgcaatttttggtttaaaaaattgatttttttactttctttgtgtatttttttgagtttaatttccatttttcggcaataaatcgatagcagatttttaaaaaaaattttcaataaaaattccaattttagaccagattccgcgtaaaccaacatattttttcaaatttaaaatattttaaacacttacatcgaaggataatcctctggcagattaattgtcattccaatatccctatcgaatttaaaaaccagctgtttatcagttgtttcttctaataaatccggaaaaatcgatgccaatgactcaatttctgctattctttgctcctcgtcgctcattttgtctgaaaaattcgatttttcgtattttttaattgaaaaatatcgaaacaataacagaaaacagttaaaaatgaataaatttccatgtgatcgagttatgc