Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y52B11C.1   

sjj_Y52B11C.1RNAiJA:Y52B11C.1
PCR_productsjj_Y52B11C.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY52B11C.1 Source_evidenceePCR456WS150 Sequence/Annotation Release
Overlaps_Gene F28D9.4 Source_evidenceePCR131WS150 Sequence/Annotation Release
Chunk_score Abs_score131
Specificity_index0.24
Rel_score0.316
Map_statusBottom50_percentile_ePCRI1116683711168727
Y52B11C.1 Source_evidenceePCR456WS150 Sequence/Annotation Release
Chunk_score Abs_score415
Max_abs_score415Y52B11C.1
Specificity_index0.76
Rel_score1
Map_statusBest_ePCRI1116683711168727
Overlaps_transcript F28D9.4 Source_evidenceePCR131WS150 Sequence/Annotation Release
Y52B11C.1 Source_evidenceePCR456WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y52B11C.11891ctattttatgaattcttccggggaggctccgcccattcattgatttttcaccattttttgaatcgaattttgccaaattgtcagaatttcagaatttcattggattttttgctaaaacttttcaaaatttctggattttttagcatacaaaaaatgggcggagcctattttgagtgtaggctccgcccatttttgtaccgaatttttatggaattggcggattgatttttttgtccaaaaatttaaacggaatctagaactttcagtacaaaatggggctatcttaggccccgcccacttcttggttttccgccatgggcggagcctaacttttgaatttctattttggctccgcccatttcttggcttttcaccgtttttgacgaaattttctcgttttaagcggaattttaccgtacttttttgagaaaacctctaaaaaattagggtttttctcaaaaattccaaaaagcccatcatgtataggctccgcccatttcttgggttttccgctaaattttcgcgtttttcatggaaattcttcttttttttttcggattttttgcactcaatgtgtgggcggagccatattttgagaatttatgtgttttggctccgcccatttcttggttttttcgctatttttcgcgtttttcaccgattttttcggcttctttttccttaaaaattaaattttcatgggcgatacctcgcatgattatggtgtccagagacaccgtgcgagtcaaatgagatgacagtatcggcagcaagtacttcaacgtgtcgcatcacaatttggcacagtgcgttgcgattccacgtgtcaccatcggcaaattcgtcataatcgaggcagatgacgtcactcgctgagattcccagcttcgaggcagcacgcgacagctcacgggcacggattttaccctgaaaagtagtttgtagtctacaaatacactacaaactacaaaatcgttttttctagaatagattttgtgggaaaaatttgaaaaaaggtttaaaaaaatattttttttcggattttttttggaaaaatgccttaaaattgggatttttctattgaaaactcaacaattcggatttttggtttttttttaaacattttgtccagaaatcgagttttttaatgaaaaaaaaataatcaaaaattacagcgaaaaatcctaaaattcgagatttttacgcgattttactttaaaaaattcaaattttctggaaaaattgtctaaaattgggttttatgtattaaaaactcgagaaatccgggtttttggtttttttaccaaagaaaattggaaaaaatgcgtcgttatttgaccagaaattcccagattttctggaaaaaatggttaaaaatttcaaatttctgccattttttcgaatagaaaccaattattttgtagtttgtaggttgccaagggtaatatttttcgatttttttaaaagattttttaaaaatcaaaaatttttttaaaaaagaaaaatcggaaaattatcgatttttaaaaaatctaaaaattccaggaaaaaataacgaaatttttttcgatttttccaaaaattagccatcatcaaaagccaacaaatttttggtgagaggctatcgtattatgtagtttgtagtctctctctctggagcctcaccaatccatcgaaatttccattcgaaatacaaaggacaaagacacgatgaccagcttgtagaagagcacgaatagtcggcgaaaagaacattgtctcatcatcaggatgagcaatgagcaaaagaatacgagattgtgagagcagtggaatcggatgagaacgaacagcgaaaatgagtagaagaacgaggagaagagtgacgatgagcagtattaatgggagcatt