Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y53C10A.4   

sjj_Y53C10A.4 RNAi JA:Y53C10A.4
Simmer:Y53C10A.4:Repeat_b
Simmer:Y53C10A.4:Screen_A
Simmer:Y53C10A.4:Screen_B
PCR_productsjj_Y53C10A.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY53C10A.4 Source_evidenceePCR902WS150 Sequence/Annotation Release
Overlaps_Gene Y53C10A.4 Source_evidenceePCR902WS150 Sequence/Annotation Release
Chunk_score Abs_score860
Max_abs_score860Y53C10A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1198180811982992
Overlaps_transcriptY53C10A.4 Source_evidenceePCR902WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y53C10A.41185ctcgtcatacccaccatttttaggagacaactctcaccgacagctccaaggaccggaaaacgtgtacgttgcaattatgagtgaaatcgaaaggcagggtacaagactatcagaaagccagaaacaggctcttgacacgtgcccgattgcaaattgtcgactgatactgtcaacgatcaaatcgacgtctggaccttctgccaagcaacttgtgaatagcattaagtgagttctatcggaaattttaaattccggcaaattgccggtggtccgattttccggaatttttcatttttcggcaaattgccgacttgccgatttgccggaatttttcgttttcggcaaattgctgatttgtcggtttgccggaatttttcgttttcggcaaattgctgatttgtcggtttgccggaaattttcaatattataaaaaacttgttaatttctcaatgttagtaaaatagatccatcaaaaattcttccaggaagaaagtgctaaccagaacggattcccgatcgatattcggcaaaggattaaatggtccaactccaccacaacccatcatgacaattgttgatcacctccgaatggatggttttgatgctgagggaatcttcagaaagtccccgaaacagagcacattcaaagagctcaaatgtgagctagacaaaggtgtggttccagacttccataagtacaacacacatgtcttggcgtcaattctcaaggaatatttgagaagtattcctggaaagattctgttatccggaaattatgagctatggatgagagagatcgctgacgagccgaacactgagaaaaaagtctcatgctgcagagctctgctatctcatcttccaacatctcatagcatcctgctagccaatgtgttaaagcttctgaacaagatctcaaattctccaagctccaaaatgaatgcttcatccttatcagtatgccttgctccgagctttctagagagcccagatccaatggaaggagggaagaagatcccaccgttgatagagttcttaatctcccacgcagctcaagtgatgcccggcttctccacagacaatgtatttgccatcatgacctccccaatggtagatcacaatgcgaatatggtgtgctcaccggcgccaagttcttctcattctgatgatggaggatcttcacagaaa