Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y53C10A.6   

sjj_Y53C10A.6RNAiJA:Y53C10A.6
PCR_productsjj_Y53C10A.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY53C10A.6 Source_evidenceePCR936WS150 Sequence/Annotation Release
Overlaps_Gene Y53C10A.6 Source_evidenceePCR936WS150 Sequence/Annotation Release
Chunk_score Abs_score789
Max_abs_score789Y53C10A.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1200313812005017
Overlaps_transcriptY53C10A.6 Source_evidenceePCR936WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y53C10A.61880ggaaacatcatttgagacacgttttcttgtcatttttggcgaaatttcttctttttcagtcttatcggctccgattcttgcgataattcgtctcaaattcacgttggattcgtcgaaaattctacgaatttcgtttcgagcatcaagtggtcccatttgttgaaattttggctcttttatcattactctgtagaatggctcaaaatcttgctcttcttcgtatccgatttgggatctctggaaaatttgggtttttgtatgaaatttcgatgaaatatcgctatttttagtgattttctcggagcgtgtcgatttacgcagctcgtgtactcctcgaggaggaggtttgccttggttttcggctcaaatgctccattttgggtaatttgttgccaatttttagaatttttctttcttttttacagttagcggctttttttttacgacaaaacgtttaaaataaagcattttagccaacttttgtggaaaaaatgcaaagaattttacaatttttatcaaaaattctcgatttttgccattttatcaattttttctcggattaaaccaaaaataatccgaaatcaagaactttagcctacaattttctgaaattttaagaataattagcttaaatcgtactttttaggctatttttatgattatttaacttttcgaaatgaaaaataaatctaaaattaagaattttggccaaaaactgtattttttctggttaaaaatcggcaatttatcgaaaaatcgataaattcgaaattttcaaaactagaaacactaaaaaggattttaaatgttctgaaatcaagttttgcagccaaaaactgcaaaatccttctccacgaggagtacactagccgcgtaaatcgacacgaagccatactttctgctcgattttcgcgtcaatctgcggcacggttttcgtcgatttgtccagcaaaacgttgataaattccttctgctcatcactcaaatccatgagattatcagtttcaaaagcctccaaatctttgatatatttgcaaacatgctctcgccaagaaatgagatgctccagcactttggaggtgtctgtggctatctgaaaattatttaaaatatgaaaattatcttgaaaactgaaattttttccagatttttatctacctgctcatattcaagcttcttctcctcaaaactcagatctttatcatctttatctctaaaaatgtgatcgagaaggcgagtagccggaggttttgggaaatttggaagaaattcgaaagcctgaacatttgcagttgtttcgcggagtattgtcagaagtgtcactgaaatagtttttatttaaatttcagcaattaaatattataattatatactcaatggtatttgacgaagcattggaacggctagaaaagcatatttttccagatcctcgagcatttccttgttatcttcctcaaattccgcatcttcttcgctcaatttgtccagagaaaactctaaatattcttcgctgacgttcgcgtcgttctgaaaatgataataaattaaaaacgatcattatttcctgatgaaacctcgaaaaactgagttatactccatggcgatagttttattggatttttcagcaggtattctcggattaaatctgccgctggtttttctgaagatgaaaattatattattattgcgaaaaaaatgaaaaaaactcaccggaagttgttgagcgctccatacgactggttttaaagctgacaaaaaagaaaataaaaataaaaataacaatgaaaactgcgcgcgtggagattgcagactggcgcgccgcagcttgcaaagggagtctccgcccattttttattgtgattttggaaggagaaaactga