Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y53G8A_9248.c   

sjj_Y53G8A_9248.c RNAi JA:Y53G8A_9248.c
Simmer:Y53G8A_9248.c
PCR_productsjj_Y53G8A_9248.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y53G8AL.2 (3)
Overlaps_transcript Y53G8AL.2.1 Source_evidenceePCR777WS150 Sequence/Annotation Release
Y53G8AL.2.2 Source_evidenceePCR773WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y53G8A_9248.c2182tttcagccattttcagtcattttcggccaattttcacgtattttaggtcatttttcatgaattatcggccaattccgtacccaaatcggcattttatacgtttcttctcccttcttgtacaaatacacataatccaatggagtttttcgccatcttgacacataatattgaataaatccatccaattcaccgtagatcacagatgggcgaataattgttgcttctgggaattcttcacgtacagcaacttctccgagtccttttgaatgaagaaattgcgattttgcgacaaaatgtcccttttgtggttgtgtagttgctccgagagccgacaaatgcacaaatttctccacacccatttctttgcaaattcgagccaaacggcgggctcccgtgtcgttgacgtcatagtaattgtactttctgcaaggaaaaatggcttaaaattgggatttttagaaggaaaaagtggggaaatttgaatttttcaatagaaaatggcagttttctcgaaaattttggagaaaaattgagcaatttagttttttttgaattttttaaaaatattttttgaattttcagtgaaaaaaacggcgcgaaactcaaaattttgaagatttttcggacatttttcaaatttttagccaaaaagtggagccaaattcaaaatttaaggggatttttcaatttttaattgattttcagttggaaaaagtgaggaattttgagtttttcaatgaaaaaactggaaaaaaagagctttttttttgaattttgaatgataatttggtgtaaaaaaatttattttttgaattttcagtaggaaaaaagggttaaattccacattttgaaggtttttcaggcattttttcgaattttcagcgaaaaagagtgatttatttggtcaaaaacggcgcgaaatttgaattttttgaatttccggcatattttgtgaatttttccgctcaaaaatctgcaatttcctcacccagtcggcacacgagttccgatcaagttgatgacgacgttcgagtactttacagcctgaaaaattgattttttctggattttctagagaaaaatccaatttttctcgattttcacctagaaaactctttttttttcggaattttctagagaaaaaacctaatttttctcgattttcactgagaaaactctattttttctgaattttctaaagaaaaacccattttttctcgattttcactgagaaaactctattttttctggattttctagagaaaaatccaatttttctcgattttcacctagaaaactcgatttttctctcaatttccacgaattttaatacctttcgaatgctctcctcatccatcagctcaaatggaaaatagaggacttgtccgagctcgccgagcactttgtgctctctcatgtaatacggatcctggcgatacggaataatgatttgtgagccatttttcgcgaatttattgacaactggaagtcccaagaagcctgacgcaccgaatacggtcaccacattgccggagaaggaggctctgcaaaaatttggaatttttaacgattttttttgggaaaaaattgattttttttcaatgttttttcaatttttcctagattttttccacattttccagtttcaaatcattcttaggcttttcctgtaccttccaccggctccctttctgaattgagcactctgagagctgacacgtggctccggatgagcattttcggcggaggtgaccgcgctgctgaaattctgacttccaacgaccgaaaccgcctgccgggcgcccaagccggatctacccaacactgatagcatggctgaaattaggaaaatcgagatttgcaattgtttaaagatttttaaagatttttaaagactttttaagaattaaatgggttttctgcgttttttcgggattttttccagctaaaaatagcttttccggtcgaaaaaatcgattttttatcaaaaaagcaccgaaaatagcgaaaaaatctggaaaaaccgctaaaaatggctgaaaatgaagtacgcggtgccgaaataaataatttggcctgtacgcaatatggcgtcgggtttgacgtttgcggactcgaatgcgcacttggaagggcggggattgatgaccgtactccaaggaggaatgagaagctttgaaat