Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y53G8A_9248.c_f   

sjj_Y53G8A_9248.c_fSequenceTTTCAGCCATTTTCAGTCATTTT
PCR_productsjj_Y53G8A_9248.c