Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E10A_155.d   

sjj_Y54E10A_155.d RNAi JA:Y54E10A_155.d
Simmer:Y54E10A_155.d:Repeat_b
Simmer:Y54E10A_155.d:Screen_A
Simmer:Y54E10A_155.d:Screen_B
PCR_productsjj_Y54E10A_155.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY54E10A.2 Source_evidenceePCR331WS150 Sequence/Annotation Release
Overlaps_Gene Y54E10A.2 Source_evidenceePCR331WS150 Sequence/Annotation Release
Chunk_score Abs_score310
Max_abs_score310Y54E10A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI32402823242656
Overlaps_transcriptY54E10A.2 Source_evidenceePCR331WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E10A_155.d2375caaataaataaaccgcaccttgatgtgctagaggagctccgagaaatttaaaaaaaaagaaaatgacaatgaaaaaatgtgtagaaaaaataaaatcgaaaattttatttaaaaaaaaccgtaaaaataatttttttccagtcaaatggtttttttttggcgaaattatttagtttttcggaataaaaacatttttcagcaaaaaaatttctggttttttagacaaaaatgaatttaaaaaaatgttcggtctgaaaaattcactgttttggtttttttcggcgaaattgaatttttttgtcttttttcttcaaaaatggtggttttcggtcaaaaaacacttttttttcgttttgttgcaaaagtgtgtttttttttggatttttcggacgggaaaatacgtttttttttcggtgaaacaaattttaaaaattaaaaaaatctttaaaaaaaaaatttttttggattttttttcagaaattttgctaattttcagtcgtgggcaggaaagaagtagtttttaaaagttattttgctcgaaatttgaaaaaagtttattttagttcagaaaaatcaaaattttcaaaaaaaaaatctataaattttcgagaaaagagtcaaattttgctaaaatctgaaatttcgacaacttgtagcaactggaataggctttttattaaattattttcctttcgttgatttaggcccgttttcagtaaattttggtcatttttgtgtgcccatcgacttaaaatgtgcctaaatcaaaggtggagtagtgtcagaaaaaaaaatgcacggagagcttattcacgctattcattctgtaatggacagtagtagttagagttttgaaatttttaatttggaaaaataatgattaaaaattgttaatttcgctgaaaatctggaattttcgaattccgaaaatatcgaatttttattttaaagaaaaatttggtagaatttccggaaattaaaattttagaaataacctcaaattttgcccaatttgttgtaaatttaaaaaaaattattgaagtgattgtgaaaatttggaaatttggaaaagtttaaaatctttaaatttgtagcaattttggtgtttgaaaaaacatttatactgaagatgacggcactaaaatgctcgaatatcctagtgaaatagtcttaaaaactttgaattttgaaaattattttccaaaaaagtattcaaagccttttatattcgaagcttaaaaaaaagttttaaaatgaaattttccaaaattcaaaaaaaaaatggaaataggagaaattagcttttgcaaaaaaaaaatcaaattttggaaaaaaagaatttgaaacgatttaaaatttaaaagtggagtagtgtttaaaaatttttttttatttaaaaggatagaaaatagaccgcaatgcccgaatataactgtttaaaaatttataacatttttctaatttttaatttttttaaatgaaaattttttgcaaaaatcataaaaaattgaaaaattttgaaaaattttgaaaattgctttacagttatattcggtcactatggtctgtctttttgtcatttgtagcaaattgtaatttttttacactactccacctttaatagggtcaaaaagctccgaaatatatggcatttgcaaaaaaaacacttacaaaatttacctaaaattttttctagattttttggattttttggtttttaaaaaattgaaaaactaaaattctggttttttagctgataatcagcgaaattttgactttaattccttttttttccttaaatttcaccgaaaaaagcgaaaaaatcggcagttttgagcgcaatatggcttttcaaaaataaaaatcaaatgttttagctgcgtcaaaactctctgggaatctctggaacaaacgaacgagaaatgtgctcaattcgaaacgatctgcaccccaatggctgatatggccacgtccaatgctctcaaagaaacgatggccacaaatgtgctccagcttctgctccgtctttgtgaactccactcggacaagcaggaaggatcggcgaggttcttggcgagagctcgtctggcacttgcgttggttcattcagaatcaacgttgatttgtaaattgttggataaggattcacaaagaattacgtctcttaatcaacgtctacactcgattattgagaaaaatctggggtgagttggaagttgttcaaaaaattgttttaaaaaatttaatttagtcgaagatcaagcagaaatgcctaaaaatatgaaaaaaaattgcgaaaataagtataaaactacagtactctttaaaggcgcacattactctgcaaaattgtatttatcgtcgtgtcgagacct