Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E10A_159.b   

sjj_Y54E10A_159.b RNAi JA:Y54E10A_159.b
Simmer:Y54E10A_159.b:Screen_A
Simmer:Y54E10A_159.b:Screen_B
PCR_productsjj_Y54E10A_159.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY54E10A.7 Source_evidenceePCR585WS150 Sequence/Annotation Release
Overlaps_Gene Y54E10A.7 Source_evidenceePCR627WS150 Sequence/Annotation Release
Chunk_score Abs_score564
Max_abs_score564Y54E10A.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI31625103163553
Overlaps_transcriptY54E10A.7 Source_evidenceePCR627WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E10A_159.b1044aaaaacgatgacaatggagaaaatcgacacgaaaaaccgtagagaagaagcggaaatgagagaagtgaattcagcacgcaatgatgaagagacgtttgttttcccatcgagacccgccgaccgtgtaaatcggtgcgcctttaaagtgcgtgtgtgaggaagcgtgtttcaacgcaaaaaacgctccgaaatttcgcgaaatagaattaaatttaatttttattagaatttctattgaaatatatgggattttattcaattttttgaatttccgactcaaaattaataaaaaaaagatttccaggcaatgtcagctcaccgagtggcagtgtcactgccaagaatcggcgtcacaattggtcacgcaccacaaaagctgaaaaccggaggaattgagccaagccgtcgtgctcgtctcgaagtgctccgtcgcatcgtcacccgaactgtccgtgaggaacgcgccgagctgaaatggaaccgcgccgtcgaggccaggccatatttggagagggtgaggggttttttgtttgaaaatgagtgagaaaattaaaatttaaaaaaataaaattcagctaattcaattgggtgtcgaaagaggaccacttgacgagtatacagccgaaatgatggaatggtggctgcctgagaaggatttaattacgaaaatgcatgaagtaaattgatttaaaaagatttttcgccaaaaaaaaatcatttttttcccaggtaattgttccacgattccaagaccgcgattctccattcacatcactattccgacttccaccacaacgtcttcaacaatttatccagaataagcgagaagtctggaagcgatacgatatcggagttctggaaatcgacggaaatccatttccacaaatacaagcagaccgcgtagatcaatctgaatcaattcttgatgttcttctagctgacgcccttcggaatcaccagaagaatcttcaggaaaagctggatactccgaagaaatctcaatgaatttttattattttttttgtttttgtttcgctagaatcc