Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E10B_159.b   

sjj_Y54E10B_159.bRNAiJA:Y54E10B_159.b
PCR_productsjj_Y54E10B_159.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY54E10BR.7 Source_evidenceePCR889WS150 Sequence/Annotation Release
Overlaps_Gene Y54E10BR.7 Source_evidenceePCR889WS150 Sequence/Annotation Release
Chunk_score Abs_score764
Max_abs_score764Y54E10BR.7
Specificity_index0.471
Rel_score1
Map_statusUnique_ePCRI30408323043316
Y22D7AR.1 Chunk_score Abs_score92
Specificity_index0.057
Rel_score0.12
E03H4.8 Chunk_score Abs_score398
Specificity_index0.246
Rel_score0.521
T07C12.5 Chunk_score Abs_score367
Specificity_index0.226
Rel_score0.48
Overlaps_transcriptY54E10BR.7 Source_evidenceePCR889WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E10B_159.b2485aaattagttttcagccccagaagtcgggtccgcgccggaggtgcggtccacggctggttggaaaatatcgaaaaagtttgaatttaagctcctatacctaacgagacccagctttatgcagtggagcgcgcttgcacctagatttcaaaaagcgcacacgtggagtcagaaagtccctttttcctttgatcttcaaaaaatgcgggaggagagacgcagacatctcatctgatgttgcatggttaaaagtgtgctgacgtcacagattttctgggaaaaattcccgcattttttgtagatcaaagcgcaatgagacagcctgacaccacgtgagcgcattatttctggataaatcgtacctcattaatcggtttattggtgagaagagacatatagccaagtgtagagaatacaacacatccggaaaagaatgacgtggcacagttaatgatggaggtagtgacggcgtcactgaaattgaagttgcgcgtgaaatctggtgcattgggaaaatccgcaacgcatcaaattttacgcgaaaaaatttccaaaaaacctacaaagaaaaagacgtttcattaaaaaatttgaagttcccgccaaaaaaaatgttcagagaaaatttgaatttcccgcctaaaactttttctgaaaaattttaaggctctgccaaaatatagaagaagaacaaatctcagtgcctaccagtggtgtgcggcaaatttgccgaatttgccgagaacggcaaatttcaaaaaagtagatttgccaaatttgccgtgctcggcaaatattgaaaaaagagatttgccgaatttgccgagctcggcaaattttgagatttgccgcacacccctggtgcctaccccatgcctgcctgcctgactaaatatacttttaaatttttttttaggcacacaaggcaggctaatttcacttccttaccgatagcagttattgttaaaatcattgtaactgctcagcgcgagcagcaccccgaatcctggtccaagtgagaagaaaatctgtgtagcagcagccgaccatactgcaggatccttgagtttctcgaaatccggtgtcacataataatagagaccattctttgctccaggaagaagaagtccacgtataagaagaatacttagaataatatatggagctgttgcagtcacccaaacaatttttccagacgactgtggacccttccaaagagcaaagtaaaccattataaatacagcgagtaggcacactgccattgaagtttttacacctccaagatcatcgaatcctgttgatttttgaacttcaaggactttgtatctggaaattagattttgagcggaattttctacattaccatatcgctgctattttctaaaaaaatatttagaaactgaaaaaattgccataaaaatgttatttaatgaagctgggcaggtaccatttctcgggtttctaacaattttcaggcttaaattagcggcctggaggcacgaaaaagtgcaaaataaaaaaccggaattagaactatgcaagtacgccctaataaaaatcaatactcacaaataatattcctctgacggagtggtcaatggtgtcccatttctagatattgtcacgttgaggtcatctgagcatctcggtgtattccacggattgccacatgacgcccacggaacttcggaatcccaaattttctgaaattttattgataaattgaacaattactgcgtggccttgatatacaaaaactcggccaccaattactttttgaaaaaattaaaaagagtgtcgtttggaacttactgaaagtgaaacaatagcaaaatagacggcttgagcgatgatcgcattatagaaaatggctatgaacgtgcaaatacagcagataccgtaaccgattcctgaagaaaaattacgttttttttcggattatctgatgagataacttttgaccacctcaggctaaacctaagcttaatcccaaacctaagcctaagcctaagcgtaagcctaagcgtaagcctaagcgtgagcgtaagcctaagcctaagcctgagcctgagcctaaacctaagcccatgcctaagtctaagcctaagccgaagccgaagcctaagcctaagcctaagcctaagccgaagtctaagactaagtctaagactaggcttaagactaaaaaaaccaacctcgaaacaacgggcacacctttctccatatactaacacatcctgaccgatgaaattgtccgagtacaagttccatatagaacatgggaagtcctccgatcattaacataatgaaatatggaataagaaaagcaccgccaccgtgtttgtagcatactgatgggaatctgaaacggggagtttttttttggaaaaaaaatttgagctggaaaaaatcaataaaaaccgaagtttaaagcccagactgaaaacgcgcggccaattttttaaacaaaaagctcgtgatctactgc