Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E5A.1   

sjj_Y54E5A.1RNAiJA:Y54E5A.1
PCR_productsjj_Y54E5A.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY54E5A.1 Source_evidenceePCR715WS150 Sequence/Annotation Release
Overlaps_Gene Y54E5A.1 Source_evidenceePCR715WS150 Sequence/Annotation Release
Chunk_score Abs_score631
Max_abs_score631Y54E5A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1468998414691682
Overlaps_transcriptY54E5A.1 Source_evidenceePCR715WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E5A.11699tgtaatgagtgggttttggaaattaaattggataatttgacagtttttttttggaaattattttgggaaaaaatttttgaaaaaaaaactggaaacattttttgaaaaaaattgaaaaaaaaaattatttcaaaaaaattatgaaactagtattataattattgataacttcaatttgcactgtgcgaatttctactcaaaaaactatttatttttaggcgaaattttctaacattttcggaaaaaaaaattgttttttgggtttaaaatttttttaaaataaaaataaaataaaatacttattaaactcaaccgaaaataatgatttatatcagaaattttacaacaaaaaatttctttcatcatttccaatatacttttagacaagttccatcacaaaactcacctaaaagtctcctgatcctccttaaaagcatagtgctccgagataaagtgcccagcacttggatggagtcccatactgataattgttccaaaaagtagatagaatagtgatttaacgccaaaaaagtgcagtattaataagtcgaatgagatctggaaatgtaatacaattagtttttctaaattaatacatttatttgaacaaaaattccaaaaaaattttatttcaaaaaaccaacctgaataatagcatttaaaatttccatatcagtaggagctttcttataaataatcaatggcctgaaaccatagaaaaacggttgtaaggcaagccacagaagcttccgcggcgcggtggtgaagaactcggcctcaaatgttgtagggacatctgtatctaggccatcttctcctgtaaataagcattttattcaaataacatgacaagaatcagaaaattgagtaaatttggatggtgttgtcagtttacaacttttttatagcgttagtagttttggagttacgggtcatttctctttaggccggggttgtcagtaaatttattaaattgatgttaccgtagaaatattcttcttgaaattttctacatttttgcaattcacaatattttaattgcgttcctctgcgcaaagttacaggcgttctaagtttgccaggatgagagagcgcggaggagggggagagtgcagatactgcctgcgctctcctcctcccccacactctctcaccgccaaaacttcaaagaggtttatctcggcgaggaggtaagatagaaaattacagtaagaggcaaaaaagtccagaattttattttttacacaatggacttacccaaatatcgatgatgctccacatgatacttcttaaaagacactgatatcggcacagcaatcggcaaatttgcccacattccgaaaaatcgatttttcaatgggtacttattaccaaaagccgtattatgtgaaatatcatggatggcaagtgtcattgcgtgattgattattccaccgcaaaagtaggcttcaagtattattaatatccaatcagcatcttgtaataaccaacacataaaaatttgaaatattaccaaactagacaccacgtattttagagatggatcaacgccgaatagctaaaattttcagtttcagaaaatgctcatacgttttaaaatataaactcacctttttaacttctgggtactttttcacaatttcctctcgtctactcatatgtggctgctctgttaacgtccaaataaaatcatctcgac