Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y59E1A.b   

sjj_Y59E1A.bRNAiJA:Y59E1A.b
PCR_productsjj_Y59E1A.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY59E1A.1 Source_evidenceePCR1034WS150 Sequence/Annotation Release
Overlaps_Gene Y59E1A.1 Source_evidenceePCR1034WS150 Sequence/Annotation Release
Chunk_score Abs_score950
Specificity_index0.496
Rel_score0.984
Map_statusUnique_ePCRX19398031942247
F52D2.1 Chunk_score Abs_score965
Max_abs_score965F52D2.1
Specificity_index0.504
Rel_score1
Overlaps_transcriptY59E1A.1 Source_evidenceePCR1034WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y59E1A.b2445acacggaatatggactcttttcaaaaagcttctaaacaagcatataactttatctagcttaatctctcttacccgtcatcatccgtgaagacgctagaatccattgatgggaaaactgagcgtgcagatggatgggatccaactgccttcttggattgtgagctgtcaggagacgacatctgagcagattcagggattcgcgagatatctgaaataaaaaattataactttgaataaagcatttcaagagttaaaagtcaacggcaaacatttacaggtacaacaaaagaattgaaaaggtttgaaagaaccagaaactgaaacaaaataatcaaacgcaagtaaaagtgttataaaaccaataaaaaaaagttaaaacggattctagaagtttctgcagtttgtccgaaagctccacgtgttcgtgttgttgttgttgatgcagccgcggcaacgttgcaaggtcagccaacgtggcggtcggacacgcttttttcatctttgtgcgcatgccgttgtagtcacggtttaattgttcacatgattggaatttttttcacatgggcttgagcaattttgatgaatatttttggtgttttttccctttaccaaaatgagatgaagccaataattcatttctgtttgtaaatacaagaagttatcgaaaatattcaaaaactctcctcaaaatgtcgaacctatagaggtggttttttttgaatgcagcgctactagaaactgcagtactactggaaatgcatcatataccgtataataattactttgagtacttcaacaaaaacgttttatttaaaatgaaatttcacaatcttttcacagaaaagataaaagggacataaatacatttagtagattgtacaagtgaaatttcaaatttgtgagttccatttgaatatttgaatttatattctttaccaccagtatagtccgatttgaatattctcgcaatttcgattgggttcaaggtcaatttgttgactgataaagtgcactgttggaatgtgcttcttctcattagattctgcaagaaaatcaattatctgaccaaaaaatccaagtacatataacttacatctcttattttaactgcaagttgtgttgggaaatcggttattttgtagacacagaaatgtggaaaatgaaacagatttttaattatttcactgtcaacattagaatttgtagctttgaggccaaaatgttttgcatttgtccactggtccaaataagttattggctcaaattgttctattggttcattttgattcaattttattgatttcagtgttttatcatcaaaataagatagaaaagaaacgacatcattgaatgagaaattccaaatttcgactgcatccactgggaaacattcttctggtttcaaaaaatcaataaaagattttatgatctcttttctattttttgcataattatatattcctaatgtggaaacatgcttcaataaaaacttcaaatccttgaacccaacatccatgaaattttcttcttcaatttcaattgttcgctgaccgtagcttacagtcgtaccaccataaactgctctaatgtaaatgggaaatccattgtccaagcacaaggtgatactgtgatcatgtaattcgaaatgaattgaatcgaaatgaattccaaatttattgacagcagatttcaaactgtggcatactttacgcaatcttaatctgtaatgaattggtggttatttatgtaattctgtgttacaatttgaaaggttcactcattttgaagtaatcagctggtacccaagattatgtggtttcaaactttttttatgtgacccttgttaagtctagaatattttaaaattgaaaggtctagtagccagtggtaaaagttttaatacctactcctatggttttcaatttttttttgaaatttatttatttacaataaaaaagtgacaattactcagtttttgtcactcataattttggaagtcgaaaactttggaaaaaaatttcctacatttttatacagcaattttgttttaattattcgtattaaaacttcgtattaggggtctaaaaatgctacatttctttggattttctcaattgctcatatttttcagaattttggcaattttccaaaacttttcaatttattataattgaatttagacaacattcccactggcactactccactaataatgaattcaactcacaagtccatgggctctaactttcccattactacattgatcacatctagaggcatatcgagcagatttgaagacatcacaccttcgttttgcaaattgggtctttgtttgaaatttgataattttaaaaaccgggtggcaacagccttcaagcaattaccaaacatttcgaaagaacaactgaaaattaaaaaaaaaactttggggagtcggtatattgt