Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y5H2B.e   

sjj_Y5H2B.e RNAi JA:Y5H2B.e
[cgc5655]:Y5H2B.e
PCR_productsjj_Y5H2B.e
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY5H2B.4 Source_evidenceePCR894WS150 Sequence/Annotation Release
Overlaps_Gene Y5H2B.4 Source_evidenceePCR894WS150 Sequence/Annotation Release
Chunk_score Abs_score768
Max_abs_score768Y5H2B.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV21893622191057
Overlaps_transcriptY5H2B.4 Source_evidenceePCR894WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y5H2B.e1696tttcaattcttgtcagcactttgtcccaaattgtgtcggctgctcacactagtcaagacgtaactttcttcacaactaaaatgcttgaaaccttgcttgttgtcgcttcattcacaaaatcttgctttctaataacagtccgataaactaaaaacgcctcaacagcgcaaccgctcagtttggtgacggtgctgtaggagcccaaattctgaaaatttaacctttttttaatataaaaaaaatttttagtacccgaggagtgaatatatttttctgagtgactagtttttcaaataatattgggaaaaaatcaaacaaaaatatgacaatacagtcgatgagtgcaagtcgattcgcctgaaattttcacgtaacttaaaaaattagtaaaaataatttttttgacctactcgagtcaaattgttgctctgactttcgtggattttcagcaaaagcttacaggtcaaaacaatcgtggataaaaaagtcagaatatacacgatctggaaataacgcttactattcaattaaccagaaaatgaagacttaccgttttataagttgtccaatattgataaaagcataaattcagtgagcagctaagagttacgcatccgtatggaatattgagttcaaaattgcaaaaactatacaaaactggatactcgaagacaccgtagccgattgcaatgatcggaatcaccgagttcgggaagaatggatgtttttggaggaataatattgggaaataaacggcctaaatggaaaggttattgtcataaagcactttttcacgctatagccggttatggtctcttcaaaatttgaaatcgattggctcaagatcgaacactctacaatgatttcgagcagattctgagctgtgagggattgtagtgaggagcggcgtcccggttagatgtcggccgcataccatatggatcagtggtaaaaagcttgcaaaatgagcagacaggcgaggacctctcgggttcgacccttctttagagcaaaggctcccatgccggcaccaaaacggctgcctcgcgctgcgagccgcgcctgctgcgcagaacccgaaaagtgtcggctgcacctttcgcaaaatgtcgtttggacgccaaagctttgattttccgccataatgcagaaataaggcgtgaggcgggcaggcgtcggactttgaaacgcctacctaccatagaagccctacgagcaacacattctgcagaaaaatcgaaaacaaaaaactcacgacaaatctttcaattgaaattgctaaagtaataagtgatcggctaactccaatatttgaggtgaaaaatcctatatgaaatacgaaattggcaaactcggtagattcttttatatagactgcggatattcccattgatgctagataaaccgcagtagtgctaccaagaaccacgtccaaaaaaaatcggaaccggaacagggccatatcgttttttttcctgaaatattgcggagttatctacgcctatgatttgtattatacagtgaaacttttctaaataaaaaaaacttggcgttgaccagctgttcaaaaaggtacctttcaaaatttttcagaatataaatgttcatagcaaatgcgaacaacgacgaaaataccccaattgcagtgactattaaagctgagacattcatgataggctgattatccatttctgga