Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y62E10A.j   

sjj_Y62E10A.j RNAi (3)
PCR_productsjj_Y62E10A.j
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_GeneY62E10A.11 Chunk_score Abs_score412
Max_abs_score412Y62E10A.11
Specificity_index1
Rel_score1
Overlaps_pseudogene Y62E10A.11 Source_evidenceePCR350WS150 Sequence/Annotation Release
Map_statusUnique_ePCRIV1338621113386822
WB_DNA_textsjj_Y62E10A.j612gttgttgcaaatcttgtgtgctaggcttgcaagaagcaaacgcgctccatcgaacgcaagccaatttcaacttaattctttattggaattattttcaaatcaattttccagtattcgactattttcagagtttgttcatgagcaaagaagtgatcaagccaagtgctgaaagctatttgaacaaattatacgcagatttattccatcttgtgaactcgtaagttcggaatttgtagttattaaaaagaaacgaggttaattatttcagcgtggagaaaggaagcggttctgagcttactgttcgtcttcgaaacgtcgaggccgacatcgcaagcttcaaagacgctctgaaatcgattcccgacatcggcgtcgaagagtacaaggaaagacggaaaatcgccgcgctctacaagcagattgagaagaaagatgagctcctcgacgaactcgcagccttcagccttgatggtgaattattttcaagaagatattaatatgttttaagcaagaaaaatgattttttaattgattaattatttcagcagccctcaaaaagcccgacggagagcagaagcagcgtagtgaaagtggagacaaatgagagcacat