Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y62E10A.n_b   

sjj_Y62E10A.n_bSequenceCCAAAATTTTTCAGAATGTCAGC
PCR_productsjj_Y62E10A.n