Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y62E10B.b   

sjj_Y62E10B.b RNAi JA:Y62E10B.b
Simmer:Y62E10B.b
PCR_productsjj_Y62E10B.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY62E10A.17 Source_evidenceePCR1082WS150 Sequence/Annotation Release
Overlaps_Gene Y62E10A.17 Source_evidenceePCR1082WS150 Sequence/Annotation Release
Chunk_score Abs_score1019
Max_abs_score1019Y62E10A.17
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1341365513414989
Overlaps_transcriptY62E10A.17 Source_evidenceePCR1082WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y62E10B.b1335aattcctctggctttgattcagttggcgtctctgtcaagcgtcgaagttcagatgcgactccatttccgattgcagtcaattgggggagccaaacccgttgagacacgattccaagtccatgtgaagctgatgaaaaggtctccattccattgttcagtcgcatgttgttcgacggttttggctcgattccagtgatcggagggacgactgatgtgaaaactgattcaagtgctgacatacattctctgaaatatttggaatttggcgtcagaattgagaaattggaatatagtcaacttacgtgaaatccttatcattcatcaacgcatccagatctgcatcctcgtcagccaatgcttcatgagcaacttcttgaattatatcttgaactggataatcatctcgtacagctgttccaagatcaagtcccaaatgaacagcttccgcttcgaccaaagcgatcactttgttgggaaaagccttctgtttcgcattcagttgaaccttgattccatgatctctcagttgagcgcgcatcagttcacctccattcttcagttttggccttttaagattgcatgcgatactcgaactattgagcttctccggactttgcaatcttcgtctcatttcctcgactgtgacctggaagattatttaaattttaatattgaacttctaccgtaaacgtacaaaataacatgtctgattctgtcccatagatagtcttccatgaaccacatcaaatgcctgatctttcggactttccagttcaaatccactcggaactgcattctcaataaccggagtcaaattaatgttttttcgaacattattgctcattttcggaggcggcttgaaagtgctcgggtcctgttcagtgaccggattcgggttgagaagacccgccagcttaatcgcaaattgtgcctcctcggagagcatcggtgcgtattcgaaaggtccacgtggtggttgcaactttgcatcatcagacgtgatttttccttttaaaagttgtgccaaaagggagttgtcttcttgctcggcaacggcgggttgggtagagcactctgcagagcttgaagggccagtctcttttgtggcgggtactgtaggtactgtaggttccacaggtcccaccacgggttccgttggaacagtagagttgagcgtggtgaacatctgaaaaagtaataaatgaataaattaaaatacgcgaatggattcaaaagcagacaatataaatttacagagtttaacaaaaaagttgattgtgacgaattttcgcttcttcataatatccttttttgaataatttgaatttccgcact