Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y65B4B_10.b   

sjj_Y65B4B_10.b RNAi JA:Y65B4B_10.b
Simmer:Y65B4B_10.b:Screen_A
Simmer:Y65B4B_10.b:Screen_B
PCR_productsjj_Y65B4B_10.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y65B4BR.5 Source_evidenceePCR736WS150 Sequence/Annotation Release
Chunk_score Abs_score673
Max_abs_score673Y65B4BR.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI535555536706
Overlaps_transcript (5)
WB_DNA_textsjj_Y65B4B_10.b1152ggcttaattttggctcagattttcctcaaaaacatgaaaatccaatctagaataagtagtaatgggtatattctaagattgtgcaaaagttagcttgaatttcctcgattaaagctttcctaccaagaaaaatgtgtggatattttgaatttacaagtttttcatcttttttttgtaatattctctttgaaactcctgtttctctcaaatttgtaaactttcataaacgtttttttcagggttaccacattaaacaatgaccggaagcaccgaaactcgccagaaggaagtcaaggaggttggttgttcaaagtgacgtctaaaatatttaaatttctatatttcagccacaagttgacgtttcggatgattccgacaacgaggccgtcgagcaagagctcaccgaggagcaaagacgtgtggccgaggctgctggacttggagatcacatcgacaagcaggccaagcaaagccgctccgagaagaaggcccgcaagctcttctccaagctcggactcaagcaagtgactggtgtctcccgtgtctgcattcgcaagtcgaagaacatcctcttcgtcataaacaagccagacgtgttcaagagcccaggatctgacacctacatcatcttcggagaagccaagatcgaggatctcacccaacacgcccagatgtctgctattgagaacttgaagccaactcgtgaggccccacaactcaagactgtcgaagaggacgagaatgaggatgttgaggtaattcagtaacttaatcggatttattacattaattgtacggtttaaggaggattccaccggcattgaggagaaggacatcgagcttgtcatttcccaagccaacaccacccgcaacaaggccatcagggcgcttaaggaagctgacaatgacatcgtcaatgccatcatgagccttaccatgtagcttgtttcctgatgaccttgcagatactcttgttatcgttgtatctcttgcttatcccgttttccgttccaagtaaacgtttatcagtcttttttaacttttttgttatgtttaaaaaacaattgcatcttcgaattgacctaccttttacagaaaagaacaattaaatcactgtttgtgtaaaacacccctctattgatcgagaacttt