Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y65B4B_11.a   

sjj_Y65B4B_11.aRNAiJA:Y65B4B_11.a
PCR_productsjj_Y65B4B_11.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y65B4BR.4a Source_evidenceePCR1381WS150 Sequence/Annotation Release
Y65B4BR.4b Source_evidenceePCR1375WS150 Sequence/Annotation Release
Overlaps_Gene Y65B4BR.4 Source_evidenceePCR1579WS150 Sequence/Annotation Release
Chunk_score Abs_score1453
Max_abs_score1453Y65B4BR.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI539656541832
Overlaps_transcript Y65B4BR.4b Source_evidenceePCR1375WS150 Sequence/Annotation Release
Y65B4BR.4a Source_evidenceePCR1579WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y65B4B_11.a2177tccgaatacgtcgagaatgtactttgtgaatcatgtaaatagaacgacacaatgggaagatccgagaacacaggggtatgtgaaaattttcaattttccaataatatttctatcaaaaatcacagttttaatgttttaaaagtttcagaggctccgaccaacctcttccggatggttgggaaatgcgattcaccgagcaaggcgttccattcttcatcgatcaccagtctaaaaccaccacctataatgatccaagaaccggaaaacccgtcggcccgctcggcgtcgtcggtgttcaaatggccatggagaagagtttccggtggaaaattgcacaattcagatatttatgcttggtaagggagggcgagaaattctttgattttagctataaattgatgtaaatttcagtcaaacagtgtgcctaatcatgtcaaaatcacagtatcccgtaataacgtgttcgaagactcattccaagaaattatgcgtaaaaatgcagtcgatctacgccggcggctgtacattcaattccgaggcgaagagggtctcgactatggaggtgtcgccagagaatggttcttcctgctgtcgcacgaagtgttgaatccaatgtattgcctattcatgtatgctggtaataacaattatagtcttcaaatcaatccagcttcatttgttaacccggatcatcttaagtatttcgagtatattggacgattcattgccatggtgagtgtttttttttaattgaaaatcagttgaaaattggatgaaaaattgcgaaatcgagagaaaatcgagttttccgctttttacaattgaattttaaaattttaaacgttaaattttgcagaaaattccaaaaaaaagcacttggatctaaaatttttgttttttgatgaaggaaatccttaaatatcgattttttttattttcagctcaaaaaacctggaaatttcgatgatctcaaattttcagatcaatatatttcattttctcctaaaaatgttatttttatttaaacaaatagtttttcttagaaaattcctttattttcaaatttccaggcgctattccacgggaaattcatctacagcggtttcacgatgccattctacaaaaagatgctcaacaagaagattgttttaaaggacattgaacaagtcgattcggaaatttataattcattgatgtggatcaaggataacaatatcgatgaatgcgatatggagctctattttgttgccgattacgagctgctcggcgagctcaagacttatgagcttaaggagggcggtacagagattgctgttaccgaggagaataaggtgagattttggattagctagagcttataaaaataatttttaaataaaataatttaatttaaaaaatcccaattttccagcttgaatacatcgaactgctcgttgagtggcgcttcaatcgcggtgtcgaacaacagacaaaagccttcttcaccggcttcaactcggtcttcccgttggaatggatgcagtatttcgatgaaagagagctcgagctgttgctctgcggaatgcaggacgttgatgtggacgattggcagagaaatactgtctacagacattatgctccacagagcaagcaggtaggggagaacatttgattaaaacttctttttttttaattaaaaaatacatttataggtaacctggttctggcaatgggttcgaagtctggaccaagaaaaacgtgcccggctcctacaattcgtcacaggaacgtgccgtgtgccagtcggtggattttccgagctgatgggctcgacgggaccacaactattctgtatcgagcgtgtcggcaaggagaactggctcccacggtcgcatacgtgcttcaatcgactcgacttgccgccatacagaagctacgatcagctcgtcgagaagttgagcatggcgatcgagatgacggaaggatttggaaacgagtagtctcccgttgtttttttttggttttgctggccgcctaattattgtataaccctcatatttcttctcacccacaccccattgattttccttttttttctctccatcaattaatgtttctttttttcgaatttgtgtgataattttcgtgttgtgataccacttgcttaggttctctctctctctttcctttccttctgg