Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y66H1A.4   

sjj_Y66H1A.4 RNAi JA:Y66H1A.4
Simmer:Y66H1A.4
PCR_productsjj_Y66H1A.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY66H1A.4 Source_evidenceePCR735WS150 Sequence/Annotation Release
Overlaps_Gene Y66H1A.4 Source_evidenceePCR1026WS150 Sequence/Annotation Release
Chunk_score Abs_score984
Max_abs_score984Y66H1A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV425947427045
Overlaps_transcriptY66H1A.4 Source_evidenceePCR1026WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y66H1A.41099attcttcgaaataggcgaaaatcaatttcttgtgattttcttaattttctcatatttagaaaattgaaatttctgtgaatattatgtacaagaaaacccctttttgttttgcaataccaattttttctattgaatttctcaacaaatatatttttatgtccagtttgattttattttgcacttgaataactttaaagttcaaaaattgtttgacatttcagaaatgagtttccgtggtggacgtggaggcggtggtggatttcgaggtggtcgtggtggcggtggaggcggtggattccgtggaggtcgcggcggtgacagaggtggtggcttccgtggaggacgcggtggattcggagggggcggccgtggaggttacgatcagggaccaccagaggaagttgtgctcgtcggtgtcttctcccatcagtgccaagatgatattgtttgcaacaatacgagtggaaaaatcccatatttcaatgctccaatttacttcaagaataaggaacaagtcggaaaaatcgacgagatttttggatcccccggggagaacgtaagtaatctcttaattgaaaattaatcataaatttattcgctgcagggattctccgtcacattgtcacaaggagtaaaagcctcttcattcgaaccagagtctcagctgtacattgatcccggaaagcttttaccagttgatcgtttccttccacaagccggcggagggcgtggaagaggtggtcgcggacgcggtggggatcgtggaggacgtggcagtgaccgtggaggtcgtggaggctttggaagaggcggcggcggtggattcagaggcggggatcgcggaggttttggcggtggtcgtggaggattccgaggcggagaccgtggagggttccgtggtggccgtggaggagacttcggaggtcgcggacgtggagacttcaaacgatcatacgatggtggaagtttcggaggacagaataataagagaactaaattcgaataattgtttcttctctaaaaaactgtatgttccaattgttttcatcctttttttttaccaattgttgattttctttgttttccttttctcatctgc