Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y68A4B.1   

sjj_Y68A4B.1RNAiJA:Y68A4B.1
PCR_productsjj_Y68A4B.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY68A4B.1 Source_evidenceePCR450WS150 Sequence/Annotation Release
Overlaps_Gene Y68A4B.1 Source_evidenceePCR450WS150 Sequence/Annotation Release
Chunk_score Abs_score345
Max_abs_score345Y68A4B.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1724953117251020
Overlaps_transcriptY68A4B.1 Source_evidenceePCR450WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y68A4B.11490tgttccaaaaagatttgcctaaaaggatatttttagacaaagcttgtacaattaatatctatgtgtaattgctgtcaatttcattggttgaacttttaatccaagttgtaccctttttgaatttttgtagaatcattatgtagattttctgcagtcacatgaaaattatcatacaaaaatgaagtactgccattttaaaaaccattttaaaaactatgttaaaatttaatttcttgcggtcaaagataatattgttgcattactcaccaagaaacgacacgatttactgatcaccctaatacacatttacacattttacacatttcaatatcattcatttattaataaataaattattattcattgtggggaatcacattggcgtttttccacacccatatcccatgtaatgtgctgttccgcatctgcaaaaacatggtttctgcatgatttcggaggtttttaagcttacggttgatcagccaataaacccactctggcgtcaacagcgagacaattatccctaaaaattgaaaattaagtggaagcattgtacattaaattttatgaatcccctcattcgaggagatttctgcgttttcactattgtcaaatacttatgatctactagttgctgctattgctatacttttaatctgccaagttaaaattgttcggaactcgtaaacttattcactattaatatttaaaagacctatttttcggctcttccctcttcacatgtcaggcttaggaaaagacttcacgcaaccatttttggcactgcgccagattatgcggctggtgagcgcgctgatcattgttttatcgggaaatgctatcacatcaaatatagacacaacctgccgtctctggtttctctcccgatacccgcttaaatttttaaggatattgtttttgttcttaaatcacttagctttgcaccttctcctattttggcccatcataccaattaatatctcttctgtttcaagtattttagtcgaaatcttacttatacgctgggtaataaatccctccattgttcgggtctccgtttctccacaaaaatccatcggtaccggtcgtcgagccgtctgtccattcaagagaattcagtgcgttacatgttaaggtcaattgcgattcaagacatgcggccgtccttttagcaccaacccaaaatgatcccgtttcagaaccgtaaagcgagacgtatgaatctggaaatttgttgagggaaaaagtctgattgtgtccaacttctactcaccttgcatgtattgtaactcagcttgattctgaactccactaacgactgctccctccgcagcacagcactgtccgcaactgtgcgatctccaacagcagtaaacacctgaattcatttcatatttctttgtgggtttcataaactctgccgatactatagaaacggtgttggctactatatgtacaaacgaattgtgcgcttttgatggtaaaaatat