Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y70C5C.6   

sjj_Y70C5C.6RNAiJA:Y70C5C.6
PCR_productsjj_Y70C5C.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y70C5C.6a Source_evidenceePCR722WS150 Sequence/Annotation Release
Y70C5C.6b Source_evidenceePCR673WS150 Sequence/Annotation Release
Overlaps_Gene Y70C5C.6 Source_evidenceePCR722WS150 Sequence/Annotation Release
Chunk_score Abs_score618
Max_abs_score618Y70C5C.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1672528516726347
Overlaps_transcript Y70C5C.6a Source_evidenceePCR722WS150 Sequence/Annotation Release
Y70C5C.6b Source_evidenceePCR673WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y70C5C.61063aaaatccgttggctaatcccaaagttgtttttacacctctagcgattttcagaacgttccgatcattttcagaaccttcataactttccgattttttccttaccattatcaaagaacgccagccaaacgatagccatatattcaagctcttcgagccccattgacgaaatcggaagaatcatttttgtgtagtagtaatcccagtatggccggaagttactggaaacttttcgcatttaatggccgacattttttgaaggtttacctaacaatttcagatttagacatttccttcccttctggaaatgttccaccataaaacccaaccagcaaattttcataatcctcttcctccagattatcgaacttttcagcacactcccggtactcgaggattggctcaatctgccataattttggcacaaagttccgtaacagagcttgctggaattccagtttttagagcgaagaacttcaaagtcaaacctactctatccctgtcctcaagtacttctacagttgggaaggccttgctaaccatccgccacgtcaattcaagatctcttagcacaaaactagtgagttcgaaaatattgcaattattgagagatccactgttcatttcttctctagtcattttcaactcgtgccagtttgatagaacacaatataagtttggtgtttggcgggaagttatcggagtctaaaaataagtacattcttcgggccgcttttaagctttaaatcctacatctaacgaggagcatgggccttccagttttatagttctgttcaaatgcttgtccctggttagttggatctctgaaattcgagtagttaaaaaactaaagcataactataaatcttcaaaacctactctccggcgtcatcccagcttcataacactttcggatcctgcaacttcggcacggatgagcatttgactgcctggttttacatgtacattttaagccgagctttttcgagtgatagaatctgcggaaaaatgcagcgcaggctctgaaaaattctgactagtttttgggcttacgggaaaagtctc