Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71A12C.1   

sjj_Y71A12C.1RNAiJA:Y71A12C.1
PCR_productsjj_Y71A12C.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71A12C.1 Source_evidenceePCR741WS150 Sequence/Annotation Release
Overlaps_Gene Y71A12C.1 Source_evidenceePCR741WS150 Sequence/Annotation Release
Chunk_score Abs_score699
Max_abs_score699Y71A12C.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1404206014043237
Overlaps_transcriptY71A12C.1 Source_evidenceePCR741WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71A12C.11178gttctgcccttccaaattgaaatggctctaacttcttttacgaaaaaaatgtagcaaattttaaggagattttcagtttttcctctgctccgcctgctgctcctttttccgtcgaaattttcacgaaaagtccccaccaaactacgcggcaattatgaataaattctttaatctaccatgcagccccggacacgtaaactgtaaaaaatgccggttcgacaaatgtctagaagttgggcttattcgacctgtcacggataatcgagctcgagaaatggctgcaaatttgaatttagtaaatttaatccagacattgaaggatctggatataactcgagcagataaattttcaaattacaatctaattggtccaacttctccagcagatgctatattgatcccagtaaaatattccgccaaaaaactccaaaatcctacatgccaccactggagccttctcaatcagattactactatagatttcttgaagaaaatcaattttcctcaagccataaaccccgaggaccagggttcaattattcgatccgggtacattaagcacatgcttttctcaactgcatttttaagttacacgaagaagcttggcgaaatgcgatttcctgatggttccgacattttcgatgctgaaattctcaaaactccggaattttctcatcgatttttaagagagattcgagaattactagttgacaagttggccaatttgaaagtcactcaagaggagtacttgttactttcagtcatatttctgtgtagtgaaggtatattttagttaaaaattgacgtaatttgaaaactgaaatatctcaaaaactaaaaaaagaaaaattttcaactaacaaaatatttctgagaaaataaaaagtcagttgacaattttttgatagctttaaccgcgacggagttacaggggcttttagttcggaagcaaaagagtgtgggggaggggagagtgcagacggagagagcgcgcctgcgtctcccctcccacacactctctcgcccctcaagttcaaaggctcataactctgcgggaagcaaagctatcaaaaagttttcaactaacaaagtgtagcaaattttttttagaatcgttttttatttgaaaattttatttttcagctagtcccttactgtcagaggacggaaaagcaaag