Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71F9A_270.a   

sjj_Y71F9A_270.aRNAiJA:Y71F9A_270.a
PCR_productsjj_Y71F9A_270.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71F9AL.1 Source_evidenceePCR376WS150 Sequence/Annotation Release
Overlaps_Gene Y71F9AL.1 Source_evidenceePCR403WS150 Sequence/Annotation Release
Chunk_score Abs_score349
Max_abs_score349Y71F9AL.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI29247772925727
Overlaps_transcriptY71F9AL.1 Source_evidenceePCR403WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71F9A_270.a951aaagatcgcaaaattctgattgaaatcatgattgaaatcaaaaaattaagacaatctttcaaaagaaacatgttttttcgcggcgagaccaatggcaagtctgcattttgtcgtgacggtgtatgcacagaaacaattttttttatttgttttttttttgaagcattttaagcatttaaaaacgaattttcccttcaaaaagaacttgtttagttttttttttacaatttaaaaactctaaaatttcattacaatcaggaaaagcaagagaagaagcgctgaggattgatttttcatgcagaaatctatagaaaagtttcttttttcaagtatgaataactctttcaggggctactagcgctgaggaaaaaaattgtcctctggttcaaacgcgcgcgcttagtcacaagagagcgtatttacattagttgaaagagactgaaaaaatctccaattttttgcagagaaaatgctcccggtgctagtaatcttctcgcaaagtcatgtagacttcaggatagcagaattcgaagcaatttgctcaatgttctcaataaaagtagatttatcggaaaagctgaacacaacggtatataaaattattacgagaaccccacacaaaattatcttaaattatcttacaggaccacatgttcatcgtcaatttcgaaagccatctagaagttcggaagctgctttcacgatcgattctagtcaaatatgcaattgaattatcgatcgaggcagagtcatacgatattatgtatgagcaaattgataacaagccggaaataatagaaaaattcgataaattagaggaaagctttgcgattcgattctttgcaatcgggcggaaaaagaaacttgacagtattgaacggattaaagtgagaaatcattaatttattctaatttaaattaattattttttcaatcaggctttcttagacg