Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71F9B_287.a   

sjj_Y71F9B_287.aRNAiJA:Y71F9B_287.a
PCR_productsjj_Y71F9B_287.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71F9B.6 Source_evidenceePCR786WS150 Sequence/Annotation Release
Overlaps_Gene Y71F9B.6 Source_evidenceePCR786WS150 Sequence/Annotation Release
Chunk_score Abs_score703
Max_abs_score703Y71F9B.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI27221222724377
Overlaps_transcriptY71F9B.6 Source_evidenceePCR786WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71F9B_287.a2256acaaacattttgcgtttgtcttttttatttctttcattttccgaggaaaaaacatagaaaatgaagaaaatcagtcaaataacgagaataaataaaattaattaataaaaataatgcaagcgcgctcaatcgaacgaatccgattggtggaaattcaaaaataattaggtgaaaactgttatttttccaattttcaaaaaattatataaaatctagaaaatttttttgaatttttatatcatgatattcggtcattgtggccccataggcgtgttttaaagcaatttctccactgagcgtagtccacctttaaggagacccaactattatccgtggagcgcgcttgcaccacgatttcaaaaaagcacatttttctgcgtttacataataacaatatttcacatctcaaattgcaatctatctacatgtggttgaatctcatcaattgttggctgaagcctgaactggagcaccgagcaaattggaagctcataagccaaaagatcggatttcggctcgcggagctgatcttcggcctgttcgatgtacgatttgatcgtagacttcttgtaatcattcattttaagggcgacgaggagagcggctccggcgacacattttcgattgacttttgagattagaccctggaaaaaaattgattttagatttaaatagatatgaaaatctcaaaaaaattgaaatttaaaaaaaaaccagctttgataataattataaactgattttagcttaaaatcgactataaaatattttaaaatttttaaaattgcctacagtaaccttaaaggcgcataccctaattgctttacaaatttcgcggcgagacccatcctcctccaaatgtggcctccctgtaaccattttcagattttttcttgaattttccgacagtttctcaaagtttaagcttttaaataattttttagacgtaatttatgctattttctatttttcgttgcattatgtcgataataaactaaaattaaagttttttggcctaaaattcgctctaaaaatttagattttctctggaaaaaaagattttcgatttaaatcgattagaaactgttttaaaaacttaaaattgtctacagtaaccttaaaggcgcatagcttaattgctcaacgagattcgcggcgagacccatcctcctccaaatgtggcctccctttaaccattttcagattttttcttgaattttccgacagtttctcaaagtttaagcttttaaatcattttttagacgtaatttatgctattttctattttttgttgcattatgtcgattataaactaagattaaagctttttgggctaaaagtcgctctaaaaatttagattttcaatggaaaaaaaagattttcgattcaaatcgactagaaaatgcatttaaaaagtttgaaaattgcctacagtaaccttaaaggcgcatagcttaattgctaaacgagattcgcggcgagacccatccacctccaaatgcggcctccctttaaccattatcaggttttttcttcagattttcgcaatttttgagctttttaatcactttttaagcttaatcgttgcaatttcgttctttctaaccttaagaataattttctcaaagtacacataagcagttgccaccgtatacacatcaattccattcgagaccccaagttctgccatttctcgcttcaaactcttcattttgctcaatgtcagatgaatcattgggtatttcgcctcgaaatcctcatttatcacttgtttcgccctctccgccgattcacaatgaagtgtgcttgccacgcaacactcgtgacggattacagtccgttttccgattcccaactcggaaaatgcgatcggatcgtactcatcgatgacttctgatgatggttcatctgatcggctggcgtctaaatcgcatttttcatcgattgaagttccacgttcatagcttgaatctcgatttacggcttgtggaacttcgatggtttccgcaaacatttcctccgaggtttcgccgtttcggaagctttcctgtaaaaattttcgattttttatcaacttttcacctaaaattcacattttaagactcaaaatctgctcaagtgaacgaaaaattccgaaaaaaaggtttattttagtgaaaatcttcaattttgccagtttttaagtttcataaatccattattacagaccttaacggtggagtagcgccagtggggaaatagctttaaaacacgcct