Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71G12A_201.b   

sjj_Y71G12A_201.b RNAi JA:Y71G12A_201.b
Simmer:Y71G12A_201.b:Repeat_b
Simmer:Y71G12A_201.b:Screen_A
Simmer:Y71G12A_201.b:Screen_B
PCR_productsjj_Y71G12A_201.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y71G12B.9a Source_evidenceePCR995WS150 Sequence/Annotation Release
Y71G12B.9b Source_evidenceePCR383WS150 Sequence/Annotation Release
Overlaps_Gene Y71G12B.9 Source_evidenceePCR995WS150 Sequence/Annotation Release
Chunk_score Abs_score890
Max_abs_score890Y71G12B.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI17623911764882
Overlaps_transcript Y71G12B.9b Source_evidenceePCR383WS150 Sequence/Annotation Release
Y71G12B.9a Source_evidenceePCR995WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71G12A_201.b2492taactggaatgcgtgtacaaatgaataaactacgttcaatggtcactcagcctacgacttcgaaaattattgatagttttgttcaacgtcatcaggctttcgagcagcaacaacaattccaacaccaacaccaccaacaccgaccaataatgttggctccacgtcatcatccgccgccgcccccgcattttacaccgaatcaacgggcggcggctccgtatcatccgaatatggttcaaccgaatcgtcttgctgctatgccacatagaagaccgattattggaatgcaggtgaaaatggaatgccatgaaaatttcgggccggaaaattttggaaaatcctctaaattttcaatatttgtcgaaaaaatctgacaaaaatcgtgtcaaaattcagatttccgggagaaaaatcgcatttttgagtaaaaattcgaagaaaagcgtcttaaattctagatttattagttaaaatttttttcaaattttagtcaagaaaattaagaaaaatgcgaaaatttcgagcaaaaaatatagttttttggagccgaaattgtgaaaaatgcgatttttttcgaaaaatctggacaaaaaatttcaaacaagaaaaaccacttttttaaaaaaattttcacacaatttccagcaacaaaattcggctccaccacaattcaacggtcaccaagctctcgtcccatcacctcaatcatcatctgcattttctcgtccaccaccaactcaacttgcaacacagagaagagctccaccattggcaagtaccggccttccggcaacagtcagatgggaagcaattccaccgccaaaaaatccgaatgtcgggcacaatgagccaccgcttaacaatggaggttcgtcgtgtgcaacaaaaagagcaccgcttttccacgacgagtttttgcgatgatgattttggtgtgaaaattgaaaaactcatttttttaaagtctgaaatttgaaaatttgagaaaagttttttaaaaaaagttttatgagggattttctgacaattttttataaacggaaaattacgaaaactccaaaatttgtgttctttcggaaaacgaatttgaaatttgaaccaaaattttgacaattttctggggatttttgactggaaattcgtttttcatcgatttttcctcctttaattttcggtaaaacccctgtctccaattccaggccgtgcacagccactaatcgataatacacgtgtacacgacaatacaattatgctgtgtgtaccacttgtctccactgcaaatacaatatcatcgggcgattcgacacgtctaccaaaagtaccacgaatctacgagaatctcacggcaaatcccgatttgagtgtgacgattcattcgagtgcacaggatttccgagagaattatcaaattggtggaaagattaactatgaatatctcggaggatttgatcaatatgtaggtgatgatgtttttttattgagagataaatacgaaattccattacaatcgatattttttgactgaaaaatgtctgaaaaatcaaaaattttagctaaaaattgagaatatttttgtttaaaaaaaatcattgaaattgatttttttttattccataaaaatctcggaaaagtcaattttcagtcataaatcttctgaaaattatccaaacaatgggattttctgaaattttagcttaaaaattgaggatttcccggttttttcagagaaattccattacaatcgatttttttactgaaaaatcctctggaaattaacaaaaaccaaataaaatgccctaatttttttttaaatccaaaaattgttggattttttcagaaaaaaatattttttcaattgactggtgtccaaaaaatatagaaaattcaaattttccaagaaaaatagccaaaaaaatgtaatttttgtctaacaaaaaaattgaatagcgcaaaattaaattgtcgttttttttaatttccctccggttttgaaaggaaaaaattccataaaaatcgaaattttttgactgaaaaatccatgaaaactcgaattttgagtcaaaaatcctctgaaaatgctccaaaatatgagattttctgaaatttcatcaaaaattaagaatttcacggtttaaaaaaaattccattaaaatcgatatttttcaagtgaaaaatctctggaaaactcgatgtttgagtcaaaattcgtctgaaaatgctcctttaaattgaaaaattgaaaaaaaaaccgcccacaatatttgcagaatatccaagtgttcgtccaagtgtcatctcttaaattcactggaatgaacggttacccggatccagaagatcgtatatcaattgactggggatgctcgaaattgtggccttgtaagccgaaatctcatcacaaattccgtgtacgcttccatcaagcacaactgctgccgaagaacgatcgaattacgattgtggctgtggcgaaggataaaactagcggaatt