Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71G12A_202.a   

sjj_Y71G12A_202.aRNAiJA:Y71G12A_202.a
PCR_productsjj_Y71G12A_202.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71G12B.4 Source_evidenceePCR608WS150 Sequence/Annotation Release
Overlaps_Gene Y71G12B.4 Source_evidenceePCR704WS150 Sequence/Annotation Release
Chunk_score Abs_score683
Max_abs_score683Y71G12B.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI18109461811808
Overlaps_transcriptY71G12B.4 Source_evidenceePCR704WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71G12A_202.a863acttatgagggaagccagaaatccgtgaaaagacaatttcggaaatttctaattataaggcttaaaaaacttgtagggtggctgtttttgaaaaatcagtacatttaaatttttcagatgttggcttccgtgttggaggagacagcaacatccgtcaccttgtcatgcaagtccattacatgcactcaaaacaggaacccgatgagacaggcttagagattacccacaccgaagaaccccaaccaaagctcgccgccaccatgctcctggtcaccggaggaactctgccacgtaacaagacagaatccttcgagactgcttgcatgattgaggaagacgtcgtcatgcacccattcgcctaccgtacccatactcacagacatggaaaggaggtcagcgggtggttggtgaaggaggatcaaaagcacgaggaccactggaagctcatcggacggagggatcctcagcttgctcagatgtttgtgccagttgaagatcaggcgatgacaatccagcagggagatatggtgactgcacggtgtattctgcagaacaacgagaatagagacatctcgatgggagcaactgaggaagacgaaatgtgcaatttctatattatgtactggactgatggagaagtgatgcaggacaacacttgttattcgcctggagcaccggattacaaatgggcacgagaagcagatctcaatcatattccgaagtaaacgatttttaagaagaaaaagaatgaaagaacttgtttaagataagaagaatatcaaaataaaattattgtgtgtgtgtcccgaatgagccccgaatgaaacatttttctgttgatctgtttgtgaagccttgatctt