Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71G12A_202.e   

sjj_Y71G12A_202.eRNAiJA:Y71G12A_202.e
PCR_productsjj_Y71G12A_202.e
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y71G12B.2 Source_evidenceePCR96WS150 Sequence/Annotation Release
Y71G12B.30 Source_evidenceePCR560WS150 Sequence/Annotation Release
Overlaps_Gene Y71G12B.2 Source_evidenceePCR96WS150 Sequence/Annotation Release
Chunk_score Abs_score75
Specificity_index0.097
Rel_score0.151
Map_statusBottom50_percentile_ePCRI18184021820711
Y71G12B.30 Source_evidenceePCR560WS150 Sequence/Annotation Release
Chunk_score Abs_score497
Max_abs_score497Y71G12B.30
Specificity_index0.64
Rel_score1
Map_statusBest_ePCRI18184021820711
K03D7.3 Chunk_score Abs_score204
Specificity_index0.263
Rel_score0.41
Overlaps_transcript Y71G12B.30 Source_evidenceePCR560WS150 Sequence/Annotation Release
Y71G12B.2 Source_evidenceePCR96WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71G12A_202.e2310cagcttccaaaaatcataattcgagattttgtaacttatatgactctgaaagtattacatcctgctggaatatattttcaaaactcgatttggtaaactatacttattcatagaaaaaatatctattcatgttggaggtttttgataatttttgaaaaataaataaattatgagcaagtaatcaattcattatttcgtcactggtgcagcagccacttgtgctggagcaggagccttcttgattggcgcggccgataggtcatgtccaaacgtattgatcgtgcattcctggaatagtaatttgaatggatactatcgtggtgagacccacgccaccagtttcctctacgcctacttgcctgcctgcctacgtgcctacttaagtagctcccactgcctacctacacacgtggtgccaggctatcccatcatggtttgctctacgaaaaatgcgggaatttttggtccaagaaaatgggacgtcagatcgttcttaaccatgcaaaatcagttgagaactctgcgtatcttctcccgcattttttgtagatcaacgtagatcaagccgaaataagagacactctagcctcaattagacccgtttttgctcaccatattggtagccacttgcaacactgctcccagattatcaaagtgaccacaataacacggcgccgagaagattgtcacgagcttcttgtcggcaaaaaactcgtatccatccatgacgacctgatgagcacgaacaatcaggtcgagcttaaacttttcgttgaactctttgaccgtcgcctctccaaacacatgacctgcaccacgtggcgaatcttggaacccaacgactcctgacactggatcggcccagcaaagatcggaaggaatgccgacgtcggcaatgtcagttggacgttgaaattcatcaatttgtctggaaaataagaactttttttactcattaaaacaatttttcgatttttcaaccgtctcgcagttctgttttgaccagggctccgccgacgccgcgcgcagcttaacgaagtgcgaaaggtagctatttgcaagcggccgacacgttcgggggatccgcgccgcacacgggttcctggagtgttaatagctattggagcgcgcttgcgcggcacctcataaactccagaattcgcgggaattcgatttagcagttttcggctatttttggcttctatagaaactattttcgacttttttgatttacaatattcttgagaagcatcatccgaattgaaaatgtgtaaagttatgaaatttgaccgaaaactgatggttttacagagattagtcaccacggcttaagctttcgttaaaatgtatcagaatcgtcagttcttcgatttcagagtcctcaaatatgtcattttgtagagaaaagtctgtttcagaaaagtttatgtttgaacatttaaaattgtttttattaaaaactgaaaaatcgaaaaaaatacgattttaacgtaaaattgtcgattttttgaatatttttatatcagaaattaaagaattagaatttcaaacatggatttctgtgaaacagagttttctctacaaaatgacatatttaacgactctgaaatcaaaaaactgacggtactgatacattttaacgaaagcttaagcctttttaacgaaagcttaagccaaatttcataattttacacattttcaattcgggtaatgcttctcacgaatattataaatcaaaaaattaaaaaataattttcatagaagccaaaaatagctttaaaaaactgctgttcccgcgtaacgaattcccgcgaattctagagttcgtgaggtgtcgcgcaagcgcgctccaataattatgaacgccagaggaggccgtgcgcgcactacacctttggatacatgcggcttgagtggcgccgttaggccggcgcgggcgcagttgcggcgacctaagacttaactttggtaggtgcgtgcaatggagcacatttgcaaactatcaaaaagtgtcggatattcacgttagcgtcctcatgggagccctagttttgacatgatctacctacttttagtcacccaaaactcactccaaagaaagcaaaccaaatggaatcccgccgtgcatgcacataatccgaccgccgacaatcgcacacaacggcatacaatagaatgcccactggaatgtctcgtacaacgtgacactgtatcggcgtttacattcgttatagaatccgtactgcatgttcaccggtcgactctcatgattgccacgtagcaggaacatcttttgtggatggagaagac