Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71G12A_205.b   

sjj_Y71G12A_205.bRNAiJA:Y71G12A_205.b
PCR_productsjj_Y71G12A_205.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71G12B.18 Source_evidenceePCR751WS150 Sequence/Annotation Release
Overlaps_Gene Y71G12B.18 Source_evidenceePCR751WS150 Sequence/Annotation Release
Chunk_score Abs_score667
Max_abs_score667Y71G12B.18
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI16527731655155
Overlaps_transcriptY71G12B.18 Source_evidenceePCR751WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71G12A_205.b2383actaatcttgtcgaaccatcgaaattcggcatggaaaactggacaaaatcgcgattaaatctgaaaaagtattctacgaaacaatccggaacggcaccaataaaagggcaggtggaatcaaaatattccgatatttttttcgaaatgaaatctcgtgccagtagaccgattaatttgcttctaattatttttctcatttttcttggcattgttcttttatacggacaggtatgcaaatctggcctagaaatattgacggccgcggccactaaaaaaattccataacctgaataaaaaaaaacattacctaaagttcagcacatgcatcgcacaaattttttagcccacaaattctgagcttcgtttattcgatgctaacgaaaattgaaaactcttcagatagcctgtaaggaatataggctgtcataggcctagacctaagcttaagcctaagcatatgcctaagcctaagcctaaacctaagcctaaacctgagcctgaaccatagcctaaacctgaaactgaaccatagcctaagcaatagcctaagcctgagcttaaacctgagcctgaaccatagcctaagaaatagcctaaacctatacctaatccgaatcttgagctatactagaaatgagagttatattaaaaatttaaatttccagacaacatccaccgactcagatgaactaaccgagctgcgtcccaatgttccattattcaacagttggaataagtgtatgacacacaaagtgtttaatgaaaccgatcacaaattgttctgggcgaaatttcaaatttggaccgacgaatgtgataggaacgcggaaattgaacaattgaatctggttccacttcgaaatagtgatgagattaagtttgggctcttgccagtggaggttagttgggggaactgcagggagaacgattattcgaaatttcatttgaatgtttcaagtcttccttatagtttcaagtctatggttagaaagttttaataaaaaatcaaaaatgtaaatttttttggtgaaactttgctaattttacaacattttagacaactttcaatcaaagatttctatttcatatacttttctagcgttaaaaaaattggaattcctttttcagagtgatttattgggatcttctagcaatctagtaacattgggaattggaaaagatattgatgcagagctcctttacaaacaggtaggttttttgaaaactattctaaagttgaatagcactaacttgaaattattgttgaaactttttgagtgttgtaggaaatctcttcgtaactttgaatgttcaagttttcggagttgcttcaatagtaaaactagaagcgtcctgacataatatctataacatttgtttctataagcattatggggttattcatgtgacgacgaaaaatgcaaaaatatatttttatggagaattatggtcactttgtagttggagcaggatctagtgttttaaaaatacaagtattagatttaggtctaccgtactactacagtaatccatcagtaacctggcaaatttcattattgaaaaattgatgataggttcaaagtcactgatcaactataacggctacaacttataggttattcatgtgatgaagaaaaacgtcaattgatggaatggctccaaaagttctagagcttttataactagctaaatcaattagaaaaataattctacaaatattataatttttcatcatgcttcgctacctatgggaggctctgaacgttttgaaatgttctaatccttcacctacagtaccccgcaacaaatttccacgcatcaagatttatggaagacaatttttgatctagataaactattcccttgtgttcaaaccggctttcgattttcttttgaaatgtttcctccgttagtattattatgtgattgagtaaacgaattactagatagtctaacatcagtcatccgctaccttttgcagaaaatgaacgacatcggccgtaacctgacattttacggagccgatcctatcaccgatgtcaacgcggatctctattcccgaatcggaaagtacttcccgtttgccgtcggaggggatgctgggtactcaactgcaagtgtgtatgtaaatggaacatacaaaaatcaagatgtcgtccacgtcgatttgatctactttttcgatcgtattttgaagattaaggttgaaacaatagcgcgtttaatatctattaaactttaaaaaaaattcagacctacgacaacatttggctggacgctgagggagccgagtacccattatttgacatttttcagtctaccggaagacttgacaggaaggggatcaaattctgtcaaatgagcttagaagtgcacagtccat