Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71H2_375.b   

sjj_Y71H2_375.b RNAi JA:Y71H2_375.b
Simmer:Y71H2_375.b
PCR_productsjj_Y71H2_375.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71H2AM.17 Source_evidenceePCR596WS150 Sequence/Annotation Release
Overlaps_Gene Y71H2AM.17 Source_evidenceePCR596WS150 Sequence/Annotation Release
Chunk_score Abs_score491
Max_abs_score491Y71H2AM.17
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII27669752768814
Overlaps_transcriptY71H2AM.17 Source_evidenceePCR596WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71H2_375.b1840tccaaaatatctccgaaaactgaaaaattacacattttgcacatgtaaaatttgattttttgctgaaaatttcaattttaagatcaaaaactgctcaaattccgtgaaaaattgggcaaaaaatcgatttttacagcattttcatagtgaaattgtatcaatttttactttgtgagctcttcttcaagtttgctctgatgagtaccaagagatgtcgcctgtcgcttcaacatctccattcggtggtgtggaactacctgaaaattgggaaaaattgaaaattctggagaaaaatagagaaatttgagctttttgagcaaaaaaatgcagttttttgtgattttttcttgaaaattcatagttttaagcgatttttctttgaaaatcctagttttccgagatttttgctcaaaaaatccagttttttcacgatcttctatcgaaaaaatcagattttttaaaacgattattgcctgaaaaattcaaattcccttcgaaaaatccactttttaacgattttcattgaaaaaattcagttttttaacgaatttcacgactcaaatgctcaattaaatggatttctctcgctttttccagctttgtcagtattttcaagttaaaatgagcaatttttgctcaaaaattaaattttttgtgactttcgcgtaaaaaatccacttttcaaacggtttttgtctgaaaaatttaattttcattcgaaaaatcaaaattttccgaattttcgtagctcaaattctcgttttaatggatttttctcgcttcttcccagctttttcagtgttttcaagtcaaaattagcattttgtgtgcaaaaaatccaattctctgagatttttgctaaaaataagcaatttttaacgattttcgtttaaaaattcagtttttacgattttgttgctgaaatgctcgctttaatggatttttcccagctttttcagtattttcaagtcaaaatgagcattttttgtgcaaaaacccaatttttcaggatttccagaatcccttacagttcttgtatcagtaacgatgctcggcgagaacaaatcactaatcaatcgattatttcgttcaaatctgacacccgcaagacgtcgggtgctcaattcattgccaccgtcatcctcgtcaaccggttgaattacaactccgccagcgtccattcggcttctcgacattttttcgttgttcttcgcgcgtccctggaagaaaatgtatttaaaaatgtatttttcggctgaaaaaagtcactttattaatcataaaattggaaattccgtttccttggaaatgtttcatttgtttttcgtagtctgcctgaaaaataatcattttttacgggaatttctcgttgattttaactttttcaagctcatattcatgttgataatgcgatttttcaccgtccggaaggtccaaccaatactttccaatcatttttccaatatcccaaagctgggcttctggattctcggcgcgaacttttggccacatcttccgactgtatcgcatgtagggttgaagtggtctttctggtacttttggaccacgcgatgacatatcttggaactgaattggtgattttttgaatttaaaaccaaattcttgcgtgaaaactcacatttctcgccggtgtggcttgcggatgacggaaagatgacatttttcaatctgaaatattaaattttcaaaaactaaacagaaattcgactggaaaacccagaagaaacaccaagaaaatacaaaaaaatcgatttaatttgaaaatcccctcaatgtccagtggggcgcgcttgctcattgtaggtgtggttttgtttgg